Información

Confusión sobre la uva sin semillas y el proceso normal de germinación.

Confusión sobre la uva sin semillas y el proceso normal de germinación.



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

En general, ¿la uva sin semillas por definición contiene semilla o la semilla es lo suficientemente pequeña como para que el proceso de ingestión cree la ilusión de que no hay semilla?

Si esto último es cierto, ¿la uva sin semillas es capaz de germinar?

Por último, ¿la parte de la fruta de la uva sin semillas funciona como un incentivo para que los animales la ingieran y proporcione nutrientes para las semillas en forma de heces, o puede funcionar como un nutriente en sí mismo?

Gracias


La uva sin semillas técnicamente tiene una semilla, pero la semilla no tiene una cáscara exterior dura y es microscópica / invisible. Estas semillas no son viables. Técnicamente, podría aislar el tejido de la semilla de la uva y cultivarlo en un medio de germinación especializado, pero ese proceso también funciona para cualquier otra parte de la planta de la uva. ¡Hurra esquejes! Ciertamente, la uva sin semillas no crecerá si la pones en el suelo.

La parte de la fruta de la uva sin semillas es un "cebo" para que los animales ingieran la uva y lleven las semillas dentro de sus tractos digestivos. El objetivo es la distancia, pero las heces circundantes proporcionan nutrientes adicionales. La fruta no está diseñada para alimentar a las plántulas de uva, sino para actuar como cebo para los herbívoros. La uva es principalmente azúcares y agua, lo que las convierte en un cebo excelente, pero no en un alimento vegetal increíble. Las plantas pueden producir azúcar del sol y extraer agua del suelo, pero el nitrógeno y el fósforo son más difíciles de conseguir.

Compare las frutas (que son para animales) con los cocos, que son ejemplos de frutas grandes que almacenan muchas calorías para la plántula. La pulpa del coco no es tan dulce como la fruta y es mucho más difícil de alcanzar.


La crianza convencional en uva es tediosa y requiere mucho tiempo. La larga fase juvenil de la uva retrasa la primera floración y cuajado. El uso de herramientas genómicas que incluyen la ingeniería genética, la genómica funcional, la asociación de todo el genoma y la bioinformática facilitan la explotación de rasgos para acortar los ciclos de reproducción. Se pueden lograr ciclos de reproducción cortos mediante la selección y selección de los mejores cultivares en el banco de germoplasma. Sin embargo, el desarrollo de nuevos cultivares lleva mucho tiempo. La incorporación de rasgos a la nueva variedad de uva se realiza mediante el mejoramiento convencional mediante el cruce de progenitores masculinos y femeninos con rasgos contrastantes. Además, la aplicación de marcadores moleculares puede identificar fácilmente los Loci de Rasgos Cuantitativos (QTL) que influyen en los rasgos de interés para fijar la introgresión en los cultivares de uva receptores mediante el método de retrocruzamiento. La ingeniería genética es otra herramienta que utiliza Agrobacterium tumefaciens y transformación mediada biolísticamente mediante la cual se insertan genes diana en un ADN de un nuevo cultivo de uva para la regeneración, por ejemplo, transgenes de uva. En un estudio de hibridación, en el que se utiliza una variedad sin semillas como genotipo materno, es necesaria la técnica de rescate de embriones. Algunas características a considerar en el mejoramiento de la uva incluyen tiempo de floración, rendimiento, tolerancia a la sequía, resistencia a enfermedades, contenido de azúcar y calidad del vino. Por lo tanto, la aplicación de herramientas de ingeniería genética y genómica es inevitable para la mejora de la uva.

Palabras clave: Biotecnología, Mejoramiento, Germoplasma, Marcador Molecular, QTL, Rasgo.


Artículo de revisión

  • 1 Laboratorio de Biolog & # x00EDa Molecular y Biotecnolog & # x00EDa Vegetal, Departamento de Gen & # x00E9tica Molecular y Microbiolog & # x00EDa, Pontificia Universidad Cat & # x00F3lica de Chile, Santiago, Chile
  • 2 N & # x00FAcleo de Investigaci & # x00F3n en Producci & # x00F3n Alimentar & # x00EDa, Facultad de Recursos Naturales, Escuela de Agronom & # x00EDa, Universidad Cat & # x00F3lica de Temuco, Temuco, Chile
  • 3 Ecofisiología y genómica funcional de la vid, Institut des Sciences de la Vigne et du Vin, Institut National de la Recherche Agronomique, Universit & # x00E9 de Bordeaux, Burdeos, Francia

El desarrollo del fruto de la vid es un proceso dinámico que se puede dividir en tres etapas: formación (I), rezago (II) y maduración (III), en el que ocurren cambios fisiológicos y bioquímicos que conducen a la diferenciación celular y la acumulación de diferentes solutos. Estas etapas pueden verse afectadas positiva o negativamente por múltiples factores ambientales. Durante la última década, se han realizado esfuerzos para comprender el desarrollo de las berries desde una perspectiva global. Se ha prestado especial atención a las redes transcripcionales y metabólicas asociadas con el control del desarrollo de la uva y cómo los factores externos afectan el proceso de maduración. En esta revisión, nos enfocamos en la integración de enfoques globales, incluida la proteómica, la metabolómica y especialmente la transcriptómica, para comprender el desarrollo de las bayas de uva. Se considerarán varios aspectos, incluido el desarrollo de semillas y la producción de envero de frutos sin semillas, en el que comienza la acumulación de antocianinas en la piel de la baya de las variedades coloreadas y la regulación hormonal del desarrollo de la baya y la señalización durante la maduración, centrándose en la regulación transcripcional de los receptores hormonales, proteínas. quinasas y genes relacionados con la detección de mensajeros secundarios. Finalmente, las respuestas de las bayas a diferentes factores ambientales, incluido el estrés abiótico (temperatura, estrés relacionado con el agua y radiación UV-B) y biótico (hongos y virus), y cómo pueden modificar significativamente tanto el desarrollo como la composición del fruto de la vid, serán discutido. Hasta ahora, se han logrado avances gracias a la aplicación de herramientas ómicas a diferentes niveles moleculares. Sin embargo, el potencial de estas tecnologías no debe limitarse al estudio de preguntas de un solo nivel, sino que los datos obtenidos por estas plataformas deben integrarse para desentrañar los aspectos moleculares del desarrollo de la vid. Por lo tanto, el desafío actual es la generación de nuevas herramientas que integren datos a gran escala para evaluar nuevas preguntas en este campo y apoyar las prácticas agronómicas.


Identificación de todo el genoma, análisis filogenético y perfiles de expresión de Tipo CONSTANS (COL) Genes en Vitis vinifera

los CONSTANAS (CO) El gen juega un papel importante en la floración de las plantas. Sin embargo, los otros roles precisos del CO gen son poco conocidos. Realizamos un censo genómico y análisis de patrones de expresión para Tipo CONSTANS genes en Vitis vinifera (VviCOLs) para revelar las características moleculares de VviCOLs. Doce VviCOLs se identificaron y se clonaron 11 de sus ADN complementarios de longitud completa. La alineación de secuencia múltiple sugirió la VviCOLs contenía dominios conservados de caja B y CCT. Además, clasificamos el VviCOLs en tres grupos de acuerdo con la variabilidad del segundo dominio de caja B. El análisis de Synteny mostró que se identificaron ocho pares de genes ortólogos entre la vid y Arabidopsis, lo que sugiere que ocho pares pueden descender de un ancestro evolutivo común. Análisis de expresión tisular de COLUMNA genes en el cv. Pinot Noir mostró VviCOL11a y VviCOL11b se expresaron específicamente en botones florales, mientras que VviCOL16b solo se expresaba en hojas. Diez VviCOLs se expresaron en el óvulo en desarrollo y seis de ellos mostraron mayor expresión en el óvulo del cv. Thompson Seedless que la del cv. Pinot Noir, indicando que VviCOLs estuvieron involucrados en el proceso de desarrollo de semillas o aborto de óvulos. Además, nueve de doce VviCOLs se expresaron en el cv. Las hojas de Pinot Noir y todos estos nueve genes respondieron a la aplicación de hormonas exógenas. En resumen, nuestros hallazgos proporcionan una nueva perspectiva de los estudios posteriores de VviCOLs, especialmente en términos de desarrollo de semillas y respuesta hormonal.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


Nanofertilizantes para la producción sostenible de frutas: una revisión

Se espera que la demanda de alimentos de calidad aumente con el aumento de la población en todo el mundo. Las frutas son una fuente importante de nutracéuticos, sin embargo, el agotamiento de nutrientes en los suelos está alterando el cultivo de frutas. Los fertilizantes convencionales han aumentado la producción de alimentos después de la revolución verde, pero la agricultura intensiva ha provocado la degradación del suelo y la contaminación de los alimentos por pesticidas. Los fertilizantes convencionales son poco eficientes, y la planta de cultivo usa solo alrededor del 20% o menos del fertilizante aplicado, el resto se mineraliza o se lixivia a las aguas subterráneas y ríos, lo que causa problemas de costo, eutrofización y salud humana. Alternativamente, los nanofertilizantes parecen prometedores porque las nanopartículas muestran propiedades únicas debido a sus características fisicoquímicas a nanoescala. Aquí, revisamos las aplicaciones de nanopartículas en cultivos de frutas. Los beneficios incluyen la productividad, la calidad y la vida útil de la fruta a través de sus efectos positivos sobre los rasgos anatómicos, morfológicos, fisiológicos, fisicoquímicos y moleculares. También discutimos el papel de los nanofertilizantes en la expresión, regulación y translocación de genes para mitigar el estrés abiótico.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


Conclusiones

Este estudio transcriptómico comparativo reveló un cambio más sustancial en el perfil del transcriptoma de las hojas RG que en las hojas SY durante las primeras etapas de la infección por B. cinerea (Fig. & # x200B 8 8 ). Algunos de los mecanismos de defensa putativos incluyen los siguientes: (1) las respuestas de defensa tempranas relacionadas con las paredes celulares podrían facilitar la resistencia de las hojas de SY a B. cinerea (2) Los procesos de acumulación de ROS y muerte celular facilitan la susceptibilidad de las hojas RG a B. cinerea (3) regulación de la vía ABA y genes sensibles a ROS a través de WRKY y MI B los genes pueden desempeñar un papel en la resistencia de la vid (4) las diferentes respuestas en términos del metabolismo de C / N podrían contribuir a los niveles de resistencia contrastantes (5) los atributos de preinfección de las hojas de SY contribuyen a una mayor B. cinerea resistencia debido a una mayor expresión basal de genes asociados con el metabolismo C / N, el metabolismo antioxidante y la inmunidad a B. cinerea en comparación con las de las hojas RG y (6) alta expresión basal de VaWRKY10 en vid debería ayudar en la defensa contra B. cinerea.

a y B muestran los supuestos mecanismos de defensa de las hojas RG y SY infectadas, respectivamente. El texto en azul indica genes cuya expresión se reguló negativamente o los bioprocesos asociados con conjuntos de genes cuya expresión se reguló negativamente. El texto en rojo indica expresión regulada al alza, aumento de las actividades de CAT y POX o aumento de los niveles de ABA y ROS. El texto en azul claro y rosa muestra una expresión levemente regulada hacia arriba y hacia abajo, respectivamente, y el texto en amarillo indica que no hay diferencias significativas en la expresión, las actividades de CAT y POX y los niveles de ROS. C y D muestran diferencias de expresión basal entre las hojas de control RG y SY. El texto en azul representa una expresión basal relativamente baja. El texto en rojo indica una expresión basal relativamente alta, actividades CAT y niveles de ROS. El amarillo indica que no hay diferencia significativa. RG Vitis vinifera CV. Globo rojo, SY V. amurensis Shuangyou


Materiales y métodos

Materiales de uva, B. cinerea ensayos de enfermedades y estudios fisiológicos

Las plantas RG, SY y Thompson Seedless se mantuvieron en un viñedo supervisado por el programa de mejoramiento y germoplasma de uva de la Universidad Northwest A & ampF, Shaanxi, China. Se llevaron a cabo ensayos de hojas de parra y bayas separadas, análisis estadístico y microexamen de hongos y desarrollo de lesiones, así como la medición de las actividades CAT y POD, como se describió anteriormente 7. La detección de los niveles de ABA se realizó mediante un sistema de cromatografía líquida de alta presión (HPLC) en un centro de pruebas de la Universidad Agrícola de China, como se describió anteriormente 48. Niveles de H2O2, MDA, proteínas y clorofila se midieron utilizando métodos previamente publicados 49.

Extracción de ARN

Se recolectaron muestras de tres réplicas biológicas a lo largo del tiempo, y la extracción de ARN total se llevó a cabo utilizando un E.Z.N.A. Kit de ARN vegetal (Omega Bio-tek, Norcross, GA, EE. UU.). La calidad y cantidad de ARN se evaluaron en un gel de agarosa desnaturalizado al 1,2% y un espectrofotómetro NanoDrop 1000 (Thermo Scientific, Wilmington, DE, EE. UU.), Respectivamente.

Secuenciación y procesamiento de datos de Illumina

Polar Genomics Company construyó bibliotecas de secuencia de ARN de uva específicas de hebra y se secuenciaron mediante el modo de un solo extremo en una plataforma Illumina HiSeq 2000/2500 50. Se generaron un total de 5 a 10 millones de lecturas con una longitud de 100 pb para cada biblioteca. La lectura sin procesar y el filtrado de la transcripción se realizaron como se describió anteriormente 51, y las transcripciones ensambladas finales se alinearon con el genoma 12 × PN40024 y B. cinerea B05.10 conjuntos genómicos 52,53 utilizando BLAT 54, con una identidad de secuencia ≥97%. Después de la alineación, los recuentos de lecturas mapeadas de cada muestra se derivaron y normalizaron a lecturas por kilobase de modelo de exón por millón de lecturas mapeadas (RPKM). Genes que se expresaron diferencialmente entre B. cinerea-Las muestras inoculadas y las muestras de control se identificaron utilizando el paquete DESeq 1.8.3 55. Genes con un ajuste PAG valor ≤ 0,05 y al menos un cambio doble en la expresión se consideraron DEG.

Análisis de los datos

Se utilizó el sistema "Calcular y dibujar diagramas de Venn personalizados" (http://bioinformatics.psb.ugent.be/webtools/Venn/) para construir diagramas de Venn. Las correlaciones y PCA entre muestras se realizaron utilizando una herramienta en línea (http://www.omicshare.com/tools). Las categorías de Ontología Genética (GO) asociadas con los conjuntos de DEG se determinaron utilizando el sistema Plant MetGenMAP 56. La agrupación de genes se realizó mediante agrupación de K-means utilizando el software Genesis 57. Los TF se confirmaron en línea utilizando la alineación Hmmscan (http: //www.plantTFdb/animalTFdb). Los sitios de unión de TF (TFBS) en las secuencias promotoras correspondientes a la región 2 kb cadena arriba del sitio de inicio de la transcripción de los genes se analizaron utilizando la base de datos JASPAR 58,59. Se utilizó una prueba hipergeométrica para generar PAG valores ajustados mediante la corrección de Benjamini-Hochberg 24. WGCNA se realizó como se describió previamente 27.

QRT-PCR y PCR semicuantitativa de transcripción inversa

Los cebadores se diseñaron utilizando el software Primer 5 60 La extracción de ARN, el tratamiento con DNasa y la transcripción inversa se llevaron a cabo como se describió anteriormente 61. Los análisis de qRT-PCR se llevaron a cabo usando SYBR Premix Ex Taq II (TaKaRa Biotechnology) en un termociclador Bio-Rad iQ5 (Bio-Rad, Hercules, CA, EE. UU.). VvActin1 (ID: XM_002282480.4 secuencia de cebador, F: GATTCTGGTGATGGTGTGAGT, R: GACAATTTCCCGTTCAGCAGT) y AtActin1 (ID: secuencia del cebador AT2G37620, F: GGCGATGAAGCTCAATCCAAACG, R: GGTCACGACCAGCAAGATCAAGACG) se utilizaron como genes de referencia. Registro relativo2 Las proporciones de inducción de las muestras tratadas en comparación con las del tratamiento de control se calcularon sobre la base de la DD. △ t método 48. Se analizaron tres réplicas biológicas y tres réplicas técnicas para cada experimento. La PCR semicuantitativa de transcripción inversa se realizó como se describió previamente 28, con cada reacción repetida tres veces y los tres análisis independientes mostrando las mismas tendencias para cada gen y muestra.

Transformación de A. thaliana y V. vinifera con VaWRKY10

VaWRKY10 y VvWRKY10 Las secuencias codificantes se amplificaron como se describió previamente 61 usando PrimeSTAR HS DNA Polymerase (TaKaRa Biotechnology) con cebadores específicos de genes (F: 5′-CGGGATCCATGGAATTCGAATTTATTGATAC-3 ′, BamH I sitio subrayado R: 5′-TCCCCCGGGTCACCATTTTTCTATCTGAG-3 ′, Sma I sitio subrayado). Las secuencias se analizaron utilizando el programa BLAST (http://Ncbi.nlm.Nih.gov/blast) de la base de datos NCBI 61. los VaWRKY10 A continuación, la secuencia codificante se fusionó con el promotor CaMV 35S en un vector pCAMBIA2300 61. El pCAMBIA2300-35S-VaWRKY10 luego se introdujo el vector en A. thaliana utilizando el método de baño floral, y se utilizó 75 mg / L de kanamicina para la identificación de plántulas transgénicas 62. los A. thaliana las plantas se cultivaron bajo 50–60% de humedad relativa a 21–23 ° C y un fotoperiodo de día largo (16 h de luz / 8 h de oscuridad). El pCAMBIA2300-35S-VaWRKY10 A continuación, se introdujo el vector de sobreexpresión en A. tumefaciens cepa GV3101. A. tumefaciens Se utilizaron cultivos que contenían el plásmido para transformar embriones somáticos del genotipo de uva Thompson Seedless (Fig. 6c). La propagación de plántulas se realizó a 25 ± 1 ° C y un fotoperiodo de 16 h 38.

A. thaliana y Thompson Seedless B. cinerea ensayos de resistencia

Se utilizaron ensayos de hojas desprendidas 7 para identificar los niveles de resistencia a B. cinerea de hojas del mismo tamaño de transgénicos de 4 semanas A. thaliana plántulas, plántulas transgénicas Thompson Seedless de dos meses y sus correspondientes líneas WT. Se analizaron tres réplicas biológicas. Gotas que contienen 1,5 × 10 6 / ml B. cinerea se aplicaron esporas a 15-18 A. thaliana hojas por repetición, y la infección se evaluó cuatro días después de la inoculación midiendo el diámetro del área de las lesiones diseminadas 61. B. cinerea Se rociaron suspensiones de esporas que contenían 1,5 × 10 6 esporas / ml sobre 15–18 hojas de parra Thompson Seedless por réplica. Luego se evaluó la infección calculando el porcentaje de lesiones diseminadas en cada hoja 7.


Abstracto

La serotonina es una indolamina antigua que presumiblemente formó parte del ciclo de vida de las primeras formas de vida procariotas en la Tierra hace millones de años, donde funcionó como un poderoso antioxidante para combatir la atmósfera cada vez más rica en oxígeno. Identificada por primera vez como una molécula de señalización de neurotransmisores en mamíferos, es ubicua en todas las formas de vida. La serotonina se descubrió en plantas muchos años después de su descubrimiento en mamíferos; sin embargo, ahora se ha confirmado en casi todas las familias de plantas, donde desempeña un papel importante en el crecimiento y desarrollo de las plantas, incluidas funciones en la adquisición de energía, ciclos estacionales, modulación del desarrollo reproductivo, control de la organogénesis de raíces y brotes, mantenimiento de los tejidos vegetales, retraso de la senescencia y respuestas a estreses bióticos y abióticos. A pesar de su presencia y actividad generalizadas, quedan muchas preguntas sin respuesta sobre el papel de la serotonina en las plantas, incluido el modo de señalización y la identidad del receptor, así como los mecanismos de acción de esta importante molécula. Esta revisión proporciona una descripción general del papel de la serotonina en la vida vegetal y su capacidad para adaptarse.


Respuestas morfológicas y fisiológicas de tara (Caesalpinia spinosa (Mol.) O. Kuntz) microdisparos a los tratamientos de ventilación y sacarosa

Uno de los principales problemas de in vitro El cultivo de tejido vegetal es la mala ventilación en los recipientes de cultivo. Esto conduce a anomalías morfológicas y fisiológicas en regenerados. in vitro plantas, un tema crucial en especies leñosas, como Caesalpinia spinosa (Mol.) O. Kuntz, que es un árbol legominoso o arbusto espinoso de los Andes, adecuado fotoautótrofo y fotomixotrófico in vitro Los sistemas de enraizamiento podrían eliminar estos problemas. Por lo tanto, el propósito del presente estudio fue evaluar tratamientos fotoautótrofos y fotomixotróficos para optimizar la in vitro enraizamiento de C. spinosa microdisparos. Los brotes micropropagados se cultivaron en recipientes sellados con una tapa de polipropileno con 0, 1 o 3 orificios de ventilación cubiertos con un microfiltro de polipropileno adhesivo de 0,45 μm. Los recipientes contenían sales MS con o sin 30 g L -1 de sacarosa o, alternativamente, un sustrato poroso (PRO-MIX®), que facilitó el enraizamiento y produjo mayores pesos frescos y secos, una mayor concentración de pigmentos fotosintéticos y compuestos fenólicos, y hojas más desarrolladas. El rendimiento óptimo y una mayor supervivencia se obtuvo mediante el uso de PRO-MIX® con tres filtros para una mayor ventilación. Para los tratamientos en agar, solo el de sacarosa y altamente ventilado (tres filtros) alcanzó un rendimiento cercano al de PRO-MIX®. Hasta la fecha, los resultados presentados no se han informado en la literatura científica para C. spinosa.

Esta es una vista previa del contenido de la suscripción, acceda a través de su institución.


13 - Irradiación de frutas y hortalizas frescas

La irradiación de alimentos es un proceso en frío para conservar alimentos y se ha establecido como un método seguro y eficaz de procesamiento y conservación de alimentos después de más de cinco décadas de investigación y desarrollo. Aunque durante algún tiempo se ha llegado a un consenso en la comunidad científica sobre la salubridad de la irradiación gamma de los alimentos, el público en general sigue preocupado por esta tecnología a pesar de que varios informes recientes muestran un interés creciente en la irradiación de alimentos por parte de los reguladores gubernamentales y la industria y la disminución aprensión del público. La irradiación de alimentos no es una tecnología nueva. En la actualidad, está aprobado por más de 40 países para más de 100 alimentos de irradiación o grupos de alimentos para el consumo. Este capítulo analiza la acción de la radiación ionizante, las fuentes de radiación ionizante y los conceptos de dosis y diferentes niveles de dosis utilizados en el procesamiento de la radiación. También incluye desinfestación, extensión de la vida útil, descontaminación y ventajas y desventajas de la irradiación de alimentos, con especial énfasis en las aplicaciones de frutas y verduras en el ámbito de la irradiación. El capítulo examina además el estado actual de los métodos analíticos utilizados en la detección de frutas y hortalizas irradiadas con métodos de detección analíticos y presenta un resumen de las aplicaciones relativas a la conservación de frutas y hortalizas.


Ver el vídeo: Aprende A Cultivar Uvas En Tu Casa, Es Más Fácil De Lo Que Parece RC 139 (Agosto 2022).