Información

¿Cómo pueden ambas cadenas de ADN codificar proteínas con funciones similares?

¿Cómo pueden ambas cadenas de ADN codificar proteínas con funciones similares?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

No está claro a partir de la pregunta, pero por ejemplo:

AAAAAAA

TTTTTTT

La hebra superior crearía una proteína diferente a la inferior, y con la gran cantidad de nucleótidos en un gen, creo que es muy poco probable que la misma región en ambos genes pueda crear proteínas que sean similares entre sí, a pesar de que son alelos del mismo gen. Esto también afectaría la codominancia / dominancia incompleta, ya que supongo que solo una de las hebras crearía una proteína funcional.


Estás confundiendo las cadenas directas e inversas del ADN como dos alelos. No son. Recuerde que tiene un ADN de doble hebra de cada padre. Cada una de esas dos piezas de doble cadena El ADN representa alelos para un locus dado.

Para el ejemplo que dio, puede tener diferentes genes que se superponen en la misma región de ADN. Uno está en una hebra y un gen diferente en la otra. El ADN se lee de 5 'a 3', por lo que pensamos en una hebra como hacia adelante y una hebra como hacia atrás.

Vea la imagen incrustada para ver ejemplos de esta publicación sobre diferentes tipos de superposición y si se conservan entre especies.


Creo que es muy poco probable que la misma región en ambos genes pueda crear proteínas similares entre sí, aunque sean alelos del mismo gen.

Creo que tu razonamiento aquí es incorrecto. No es que los dos alelos estén en el mismo cromosoma y cada uno en una hebra. Cada alelo está en un cromosoma diferente (uno de cada padre).

Los genes superpuestos o anidados son un tema completamente diferente.


En general, los genes que codifican proteínas no se superponen, por lo que el problema que ha identificado no surge.

Y no, las hebras complementarias no son alelos diferentes. Si fuera así, las bacterias y los gametos tendrían dos alelos de cada gen, porque cada uno de ellos contiene una copia bicatenaria del genoma.

Tienes dos copias de cada cromosoma bicatenario, por eso tienes dos alelos para cada gen.


Por lo general, no todo el gen se superpone y, por lo general, no está dentro del marco, esto lo hace mucho más fácil.

También tiene cierta flexibilidad debido a los codones redundantes (20 AA para 64 codones), por lo que puede cambiar más o menos cada tercera base para adaptarse al "otro" gen.

"Similar" podría significar cualquier cosa, posiblemente refiriéndose a dos proteínas que no son ni siquiera un 20% idénticas. Con un 20% de identidad, aún puede estar seguro de que esa enzima es de la misma clase, catalizando la misma reacción. Puede aceptar diferentes sustratos, pero también puede aceptar los mismos sustratos.

Juntos, esto significa que en la hebra no codificante de cada gen se puede colocar un gen que codifique una proteína que haga más o menos lo mismo.


¿Cómo pueden ambas cadenas de ADN codificar proteínas con funciones similares? - biología

21. ADN y biotecnología

En el capítulo anterior, aprendimos sobre la base cromosómica de la herencia. En este capítulo, nos familiarizaremos con la estructura y función del ADN y descubriremos cómo esta molécula puede servir como base de nuestra herencia genética y como fuente de la diversidad de la vida en la Tierra. Aprendemos que la importancia del ADN a nivel personal radica en que dirige la síntesis de polipéptidos (proteínas) específicos que desempeñan funciones estructurales o funcionales en nuestros cuerpos. Luego consideramos la tecnología que nuestro conocimiento del ADN ya ha puesto a disposición y qué posibilidades puede tener dicha tecnología para el futuro.

Forma de ADN

A veces se hace referencia al ADN como el hilo de la vida, y es un hilo muy delgado. Cuando el ADN se desenrolla, mide apenas 50 billonésimas de pulgada de diámetro. Si todas las hebras de ADN en una sola célula estuvieran unidas juntas de un extremo a otro, el hilo se estiraría más de 5 pies de largo. El ADN también podría considerarse el hilo que une toda la vida, porque el ADN de organismos que van desde bacterias hasta humanos se construye a partir de los mismos tipos de subunidades. El orden de estas subunidades codifica la información necesaria para producir las proteínas que construyen y mantienen la vida.

El ácido desoxirribonucleico, o ADN, es una molécula de doble hebra que se asemeja a una escalera y que se retuerce suavemente para formar una espiral llamada doble hélice, como se muestra en la figura 21.1. Cada lado de la escalera, incluida la mitad de cada peldaño, está formado por una cadena de subunidades repetidas llamadas nucleótidos. Tal vez recuerde del capítulo 2 que un nucleótido se compone de tres subunidades, incluido un azúcar (desoxirribosa, en el ADN), un fosfato y una base nitrogenada. El ADN contiene cuatro tipos de bases nitrogenadas: adenina (A), guanina (G), timina (T) y citosina (C). Los lados de la escalera se componen de azúcares y fosfatos alternados, los peldaños consisten en bases nitrogenadas emparejadas. Las bases se unen entre sí de acuerdo con las reglas del emparejamiento de bases complementarias: la adenina se empareja solo con la timina (creando un par A-T), y la citosina se empareja solo con la guanina (creando un par C-G). Cada par de bases se mantiene unido por enlaces de hidrógeno débiles. El apareamiento de bases complementarias es específico debido a las formas de las bases y al número de enlaces de hidrógeno que se pueden formar entre ellas. También recordará del capítulo 2 que una molécula formada por la unión de nucleótidos se llama ácido nucleico. Por tanto, el ADN es un ácido nucleico.

· Una huella de ADN se basa en la secuencia de bases en el ADN de una persona. Por lo tanto, una huella de ADN es única para cada persona (excepto para aquellos que tienen hermanos idénticos).

FIGURA 21.1. El ADN es una molécula de doble hebra que se retuerce para formar una estructura en espiral llamada doble hélice.

Debido a que el emparejamiento de bases es tan específico, las bases de una hebra de ADN son siempre complementarias a las bases de la otra hebra. Por tanto, el orden de las bases en una hebra determina la secuencia de bases en la otra hebra. Por ejemplo, si la secuencia de bases en una hebra fuera CATATGAG, ¿cuál sería la secuencia complementaria? Recuerde, la citosina (C) siempre se empareja con la guanina (G) y la adenina (A) siempre se empareja con la timina (T). Como resultado, la secuencia complementaria en la hebra opuesta sería GTATACTC.

El ADN dentro de cada célula humana tiene la asombrosa cantidad de 3 mil millones de pares de bases. Aunque el emparejamiento de adenina con timina y citosina con guanina es específico y no varía, la secuencia de bases a lo largo de las diferentes moléculas de ADN puede variar de innumerables formas. Como veremos, la información genética está codificada en la secuencia exacta de bases.

Replicación de ADN

Para que el ADN sea la base de la herencia, sus instrucciones genéticas deben transmitirse de una generación a la siguiente. Además, para que el ADN dirija las actividades de cada célula, sus instrucciones deben estar presentes en cada célula. Estos requisitos exigen que el ADN se copie antes de la división celular tanto mitótica como meiótica (véase el capítulo 19). Es importante que las copias sean exactas. La clave de la precisión del proceso de copia es que las bases son complementarias.

El proceso de copia, o replicación del ADN, comienza cuando una enzima rompe los enlaces de hidrógeno débiles que mantienen unidas las bases emparejadas que forman las hebras de nucleótidos de la doble hélice, por lo que "descomprime" y desenrolla las hebras. Como resultado, las bases nitrogenadas en las regiones separadas de cada hebra quedan expuestas temporalmente. Las bases de nucleótidos libres, que siempre están presentes dentro del núcleo, pueden unirse a bases complementarias en las hebras de ADN abiertas. Las enzimas llamadas ADN polimerasas unen los azúcares y fosfatos de los nucleótidos recién unidos para formar una nueva hebra. A medida que se forma cada una de las nuevas moléculas de ADN de doble cadena, se retuerce en una doble hélice.

Cada hebra de la molécula de ADN original sirve como plantilla para la formación de una nueva hebra. Este proceso se denomina replicación semiconservadora, porque en cada una de las nuevas moléculas de ADN de doble hebra, una hebra original (madre) se guarda (conserva) y la otra hebra (hija) es nueva. Mire la figura 21.2. Observe la cadena de nucleótidos original (parental) en cada nueva molécula de ADN. El emparejamiento de bases complementarias crea dos nuevas moléculas de ADN que son idénticas a la molécula madre.

FIGURA 21.2. La replicación del ADN se denomina semiconservativa porque cada molécula hija consta de una hebra "parental" y una hebra "nueva".

La expresion genica

El proceso de replicación asegura que la información genética se transmita con precisión de una célula madre a las células hijas y de una generación a otra. La siguiente pregunta obvia es: "¿Cómo emite el ADN órdenes que dirigen las actividades celulares?" La respuesta es que el ADN dirige la síntesis de otro ácido nucleico: el ácido ribonucleico o ARN. El ARN, a su vez, dirige la síntesis de un polipéptido (una parte de una proteína) o una proteína. La proteína puede ser una parte estructural de la célula o desempeñar un papel funcional, como una enzima que acelera ciertas reacciones químicas dentro de la célula.

Recuerde del Capítulo 20 que un gen es un segmento de ADN que contiene las instrucciones para producir una proteína específica (o en algunos casos, un polipéptido específico) .1 La secuencia de bases en el ADN determina la secuencia de bases en el ARN, que a su vez determina la secuencia de aminoácidos de una proteína. Decimos que el gen se expresa cuando se produce la proteína que codifica. La proteína resultante es la base molecular del rasgo heredado que determina el fenotipo.

Para apreciar más plenamente cómo funciona la expresión génica, consideraremos cada paso con un poco más de detalle.

Así como el director ejecutivo de una empresa importante emite comandos desde la sede en lugar de desde la fábrica, el ADN emite instrucciones desde el núcleo de la célula y no desde el citoplasma donde se realiza el trabajo de la célula. El ARN es el intermediario que transporta la información codificada en el ADN desde el núcleo hasta el citoplasma y dirige la síntesis de la proteína especificada.

Al igual que el ADN, el ARN está compuesto por nucleótidos unidos entre sí, pero existen algunas diferencias importantes entre el ADN y el ARN, como se muestra en la Tabla 21.1. Primero, los nucleótidos del ARN contienen el azúcar ribosa, en lugar de la desoxirribosa que se encuentra en el ADN. En segundo lugar, en el ARN, el nucleótido uracilo (U) se empareja con la adenina, mientras que en el ADN la timina (T) se empareja con la adenina (A). En tercer lugar, la mayor parte del ARN es monocatenario. Recuerde que el ADN es una molécula de doble hebra.

TABLA 21.1. Comparaciones de ADN y ARN

Están compuestos de nucleótidos enlazados.

Tener una columna vertebral de azúcar y fosfato

Es una molécula de doble hebra.

Es una molécula monocatenaria.

Contiene las bases adenina, guanina, citosina y timina.

Contiene las bases adenina, guanina, citosina y uracilo (en lugar de timina)

Funciones principalmente en el núcleo.

Funciones principalmente en el citoplasma.

El primer paso para convertir el mensaje de ADN en una proteína es copiar el mensaje como ARN, mediante un proceso llamado transcripción.

En las células se producen tres tipos de ARN. Cada uno juega un papel diferente en la síntesis de proteínas (tabla 21.2). El ARN mensajero (ARNm) lleva las instrucciones del ADN para sintetizar una proteína particular desde el núcleo hasta el citoplasma. El orden de las bases en el ARNm especifica la secuencia de aminoácidos en la proteína resultante, como veremos. Cada molécula de ARN de transferencia (ARNt) está especializada para llevar un aminoácido específico al lugar donde se puede agregar a un polipéptido que está en construcción. El ARN ribosómico (ARNr) se combina con proteínas para formar ribosomas, que son las estructuras en las que se produce la síntesis de proteínas.

TABLA 21.2. Revisión de las funciones del ARN

Transporta la información del ADN en la secuencia de sus bases (codones) desde el núcleo hasta el citoplasma.

Se une a un aminoácido específico y lo transporta para agregarlo, según corresponda, a una cadena polipeptídica en crecimiento.

Se combina con proteínas para formar ribosomas (estructuras en las que se sintetizan los polipéptidos)

La transcripción comienza con el desenrollado y descompresión de la región específica del ADN que se va a copiar; estas acciones las realiza una enzima. El mensaje de ADN está determinado por el orden de las bases en la región descomprimida de la molécula de ADN. Una de las hebras desenrolladas de la molécula de ADN sirve como molde durante la transcripción. Los nucleótidos de ARN presentes en el par de núcleos con sus bases complementarias en la plantilla: citosina con guanina y uracilo con adenina (figura 21.3). La señal para iniciar la transcripción viene dada por una secuencia específica de bases en el ADN, llamada promotor. Una enzima llamada ARN polimerasa se une con el promotor en el ADN y luego se mueve a lo largo de la hebra de ADN, abriendo la hélice de ADN frente a ella y luego alineando los nucleótidos de ARN apropiados y uniéndolos a la región de ADN que se ha transcrito. La ARN polimerasa pasa. Otra secuencia de bases en el ADN indica a la ARN polimerasa que detenga la transcripción. Una vez que cesa la transcripción, la cadena de ARN recién formada, llamada transcripción de ARN, se libera del ADN.

FIGURA 21.3. La transcripción es el proceso de producción de ARN a partir de una plantilla de ADN.

El ARN mensajero suele sufrir ciertas modificaciones antes de salir del núcleo (figura 21.4). La mayoría de los tramos de ADN entre un promotor y la señal de parada incluyen regiones que no contienen códigos que se traducirán en proteínas. Estas regiones de ADN no expresadas se denominan intrones, abreviatura de secuencias intermedias. Las regiones de ARNm correspondientes a los intrones son eliminadas de la cadena de ARNm recién formada por enzimas antes de que la cadena abandone el núcleo. Los segmentos restantes de ADN o ARNm, llamados exones para las secuencias expresadas, se empalman para formar la secuencia que dirige la síntesis de una proteína.

FIGURA 21.4. El ARN mensajero recién formado se modifica antes de que abandone el núcleo. Las regiones no codificantes de ADN llamadas intrones se eliminan de las regiones correspondientes de la molécula de ARNm. Luego, los segmentos de ARNm que codifican proteínas se empalman.

El ARNm recién formado lleva el mensaje genético (transcrito del ADN) desde el núcleo hasta el citoplasma, donde se traduce en proteína en los ribosomas. Así como podríamos traducir un mensaje escrito en español al inglés, la traducción convierte el lenguaje de nucleótidos del ARNm en el lenguaje de aminoácidos de una proteína.

Antes de examinar el proceso de traducción, deberíamos familiarizarnos más con el lenguaje del ARNm.

El codigo genetico . Para usar cualquier idioma, debe saber qué son las palabras y qué significan, así como dónde comienzan y terminan las oraciones. El código genético es el "lenguaje" de genes que traduce la secuencia de bases del ADN en la secuencia específica de aminoácidos de una proteína. Hemos visto que la secuencia de bases en el ADN determina la secuencia de bases en el ARNm a través del apareamiento de bases complementarias. Las "palabras" en el código genético, llamadas codones, son secuencias de tres bases en el ARNm que especifican 1 de los 20 aminoácidos o el comienzo o el final de la cadena de proteínas. Todos los codones del código genético se muestran en la Figura 21.5. Por ejemplo, el codón UUC en el ARNm especifica el aminoácido fenilalanina. (La secuencia complementaria en el ADN sería AAG).

FIGURA 21.5. El código genético. Cada secuencia de tres bases en las moléculas de ARNm, llamada codón, especifica un aminoácido específico, una señal de inicio o una señal de parada.

Si la secuencia de bases que sigue a una señal de inicio fuera AACUCAGCC, ¿qué aminoácidos se especificarían?

Asparagina, serina, alanina

Observe la hebra de ARNm de la figura 21.3. Observe que el codón al final de la cadena de ARNm es ACG. ¿Qué aminoácido especifica esto? (Utilice la figura 21.5.)

Las cuatro bases del ARN (A, U, C y G) podrían formar 64 combinaciones de secuencias de tres bases. El número de posibles codones, por tanto, excede el número de aminoácidos. Como indica la figura 21.5, hay varios conjuntos de codones que codifican el mismo aminoácido. Tenga en cuenta también que el codón AUG puede servir como señal de inicio para iniciar la traducción o puede especificar la adición del aminoácido metionina a la cadena de proteína en crecimiento, dependiendo de dónde se produzca en la molécula de ARNm. Además, tres codones (UAA, UAG y UGA) son codones de parada que señalan el final de una proteína y que no codifican un aminoácido. Si pensamos en los codones como palabras genéticas, entonces un codón de terminación funciona como el punto al final de la oración.

Transferir ARN Un intérprete de idiomas traduce un mensaje de un idioma a otro. El ARN de transferencia (ARNt) sirve como un intérprete que convierte el mensaje genético transportado por el ARNm en el lenguaje de la proteína, que es una secuencia particular de aminoácidos. Para lograr esta conversión, una molécula de ARNt debe ser capaz de reconocer tanto el codón en el ARNm como el aminoácido que especifica el codón; en otras palabras, debe hablar ambos idiomas.

Hay muchos tipos de ARNt, al menos uno para cada uno de los 20 aminoácidos. Cada tipo de molécula de ARNt se une a un aminoácido en particular. Las enzimas aseguran que el ARNt se una al aminoácido correcto. El tRNA luego transporta el aminoácido a la ubicación correcta a lo largo de una hebra de mRNA (Figura 21.6).

FIGURA 21.6. Una molécula de ARNt es una hebra corta de ARN que se retuerce y se pliega sobre sí misma. La función del ARNt es transportar un aminoácido específico al ribosoma e insertarlo en la posición adecuada en la cadena de péptidos en crecimiento.

¿Cómo sabe el ARNt la ubicación correcta a lo largo del ARNm? La ubicación está determinada por una secuencia de tres nucleótidos en el ARNt llamado anticodón. En cierto sentido, el anticodón "lee" el lenguaje del ARNm uniéndose a un codón en la molécula de ARNm de acuerdo con las reglas complementarias de apareamiento de bases. Cuando el anticodón del ARNt se une al codón del ARNm, el aminoácido específico unido al ARNt se lleva a la cadena polipeptídica en crecimiento. Por ejemplo, una molécula de ARNt con el anticodón AAG se une al aminoácido fenilalanina y lo transporta a la molécula de ARNm, donde se presenta el codón UUC para su traducción. Luego, se agregará fenilalanina a la cadena de aminoácidos en crecimiento.

Ribosomas . Los ribosomas funcionan como bancos de trabajo sobre los que se construyen las proteínas a partir de los aminoácidos. Un ribosoma consta de dos subunidades (pequeñas y grandes), cada una compuesta de ARN ribosómico (ARNr) y proteína. Las subunidades se forman en el núcleo y se envían al citoplasma. Permanecen separados excepto durante la síntesis de proteínas. El papel del ribosoma en la síntesis de proteínas es acercar el ARNt que lleva un aminoácido al ARNm lo suficiente para interactuar. Como puede ver en la figura 21.7, cuando las dos subunidades encajan para formar un ribosoma funcional, se forma un surco para el ARNm.Dos sitios de unión colocan las moléculas de ARNt de modo que una enzima en el ribosoma pueda hacer que se formen enlaces entre sus aminoácidos.

FIGURA 21.7. Un ribosoma consta de dos subunidades de diferentes tamaños. Cuando las dos subunidades se unen para formar un ribosoma funcional, se forma un surco para el ARNm. El ribosoma tiene dos sitios de unión para las moléculas de ARNt. También contiene una enzima que promueve la formación de un enlace peptídico entre los aminoácidos que están unidos a los ARNt en los sitios de unión.

Síntesis de proteínas . La traducción, esencialmente la síntesis de proteínas, se puede dividir en tres etapas: iniciación, alargamiento y terminación.

1. Durante el inicio, los principales actores de la síntesis de proteínas (ARNm, ARNt y ribosomas) se unen (Figura 21.8).

• Paso 1: la subunidad ribosómica pequeña se une a la cadena de ARNm en el codón de inicio, AUG.

• Paso 2: El tRNA con el anticodón complementario se empareja con el codón de inicio. La subunidad ribosómica más grande luego se une a la más pequeña para formar un ribosoma intacto funcional con ARNm colocado en un surco entre las dos subunidades.

FIGURA 21.8. Inicio de la traducción

2. El alargamiento de la proteína ocurre cuando se agregan aminoácidos adicionales a la cadena (Figura 21.9).

• Paso 1: Reconocimiento de codones. Con el codón de inicio posicionado en un sitio de unión, el siguiente codón se alinea en el otro sitio de unión.

• Paso 2: Formación de enlaces peptídicos. El ARNt que lleva un anticodón que se emparejará con el codón expuesto se desliza en su lugar en el sitio de unión, y el aminoácido que transporta forma un enlace peptídico con el aminoácido anterior con la ayuda de enzimas.

• Paso 3: Movimiento del ribosoma. El tRNA en el primer sitio de unión sale del ribosoma. El ribosoma se mueve a lo largo de la molécula de ARNm, llevando la cadena peptídica en crecimiento y el ARNt restante con su aminoácido al primer sitio de unión. Este movimiento coloca el siguiente codón en el sitio abierto. Un ARNt apropiado se desliza hacia el sitio abierto y su aminoácido se une al anterior. Este proceso se repite muchas veces, añadiendo un aminoácido a la vez a la cadena polipeptídica en crecimiento.

FIGURA 21.9. Alargamiento del polipéptido durante la traducción

Muchos ribosomas pueden deslizarse a lo largo de una hebra de ARNm determinada al mismo tiempo, y cada uno produce su propia copia de la proteína dirigida por ese ARNm (figura 21.10). Tan pronto como un ribosoma pasa del codón de inicio, se puede unir otro ribosoma. Un grupo de ribosomas que traducen simultáneamente la misma hebra de ARNm se denomina polisoma.

FIGURA 21.10. Un polisoma es un grupo de ribosomas que leen la misma molécula de ARNm.

3. La terminación ocurre cuando un codón de parada se mueve hacia el ribosoma (figura 21.11).

• Paso 1: el codón de parada se mueve hacia el ribosoma. No hay anticodones de ARNt que se emparejen con los codones de terminación, por lo que cuando un codón de terminación se mueve hacia el ribosoma, se termina la síntesis de proteínas.

• Paso 2: Desarmar las piezas. El polipéptido recién sintetizado, la cadena de ARNm y las subunidades ribosómicas se separan entre sí.

FIGURA 21.11. Terminación de la traducción

La estreptomicina es un antibiótico, un fármaco que se toma para retardar el crecimiento de las bacterias invasoras y permitir que los mecanismos de defensa del cuerpo tengan más tiempo para destruirlas. La estreptomicina actúa uniéndose a los ribosomas bacterianos y evitando una lectura precisa del ARNm. ¿Por qué este proceso ralentizaría el crecimiento bacteriano?

El ADN es notablemente estable y los procesos de replicación, transcripción y traducción generalmente ocurren con una precisión asombrosa. Sin embargo, a veces el ADN se altera y las alteraciones pueden cambiar su mensaje. Los cambios en el ADN se denominan mutaciones. Un tipo de mutación ocurre cuando se duplican o eliminan secciones enteras de cromosomas, como se discutió en el Capítulo 20. Ahora que estamos familiarizados con la estructura química del ADN y cómo dirige la síntesis de proteínas, podemos considerar otro tipo de mutación: una mutación genética. Una mutación genética es el resultado de cambios en el orden de los nucleótidos en el ADN. Aunque una mutación genética puede ocurrir en cualquier célula, la única forma en que se puede transmitir a la descendencia es si está presente en una célula que se convertirá en un óvulo o un espermatozoide. Una mutación que ocurre en una célula del cuerpo puede afectar el funcionamiento de esa célula y las células subsiguientes producidas por esa célula, a veces con efectos desastrosos, pero no puede transmitirse a la descendencia de una persona.

Un tipo de mutación genética es el reemplazo de un par de nucleótidos por un par de nucleótidos diferente en la doble hélice del ADN. Durante la replicación del ADN, las bases pueden emparejarse accidentalmente de forma incorrecta. Por ejemplo, la adenina podría emparejarse por error con citosina en lugar de timina. Las enzimas reparadoras normalmente reemplazan la base incorrecta por la correcta. Sin embargo, a veces las enzimas reconocen que las bases están emparejadas incorrectamente, pero reemplazan por error la base original (la de la hebra antigua) en lugar de la nueva e incorrecta. El resultado es un par de bases complementarias que consta de los nucleótidos incorrectos (figura 21.12).

FIGURA 21.12. Una sustitución de pares de bases es una mutación del ADN que se produce cuando una base se empareja incorrectamente. Esto puede cambiar el aminoácido especificado por el ARNm y alterar la estructura de la proteína.

Otros tipos de mutaciones genéticas son causadas por la inserción o deleción de uno o más nucleótidos. Generalmente, una mutación de este tipo tiene efectos más graves que una mutación provocada por la sustitución de un par de bases por otro. Recuerde que el ARNm se traduce en unidades de tres nucleótidos (una unidad llamada codón). Si se insertan o eliminan uno o dos nucleótidos, es probable que cambien todos los codones triplete que siguen a la inserción o deleción. En consecuencia, las mutaciones debidas a la inserción o deleción de uno o dos nucleótidos pueden cambiar en gran medida la proteína resultante. Una oración que consta de palabras de tres letras (que representan codones) ilustra lo que puede suceder. Eliminar una sola letra de la oración & quot; El gran perro gordo corrió & quot hace que la oración sea absurda:

Original: EL GRAN PERRO GORDO CORRÍA

Después de la eliminación de la E en THE: THB IGF ATD OGR AN

Regulación de la actividad genética

En el momento de su concepción, recibió un juego de cromosomas de su padre y otro de su madre. El cigoto resultante comenzó entonces una notable serie de divisiones celulares, algunas de las cuales continúan en muchas de las células de su cuerpo hasta el día de hoy. Con cada división, la información genética se replicaba fielmente y se empaquetaban copias exactas en las células hijas. Por lo tanto, cada célula nucleada que posee, excepto los gametos, contiene un conjunto completo de instrucciones genéticas idénticas para crear todas las estructuras y realizar todas las funciones de su cuerpo.

Entonces, ¿cómo es posible que el hígado, los huesos, la sangre, los músculos y las células nerviosas se vean y actúen de manera tan diferente entre sí? La respuesta es engañosamente simple: solo ciertos genes están activos en un cierto tipo de célula, la mayoría de los genes están desactivados en cualquier célula, lo que conduce a la especialización para trabajos específicos. Los genes activos producen proteínas específicas que determinan la estructura y función de esa célula en particular. De hecho, a medida que las células se especializan para trabajos específicos, el momento de la actividad de genes específicos es fundamental.

Pero, ¿qué controla la actividad genética? La respuesta a esta pregunta es un poco más compleja, porque la actividad genética se controla de varias formas. Los genes están regulados en varios niveles simultáneamente.

Actividad genética a nivel cromosómico

A nivel cromosómico, la actividad genética se ve afectada por el enrollamiento y desenrollamiento del ADN. Cuando el ADN está muy enrollado o condensado, los genes no se expresan. Cuando se necesita una proteína en particular en una célula, la región del cromosoma que contiene el gen necesario se desenrolla, lo que permite que tenga lugar la transcripción. Presumiblemente, el desenrollamiento permite que las enzimas responsables de la transcripción alcancen el ADN en esa región del cromosoma. Otras regiones del cromosoma permanecen muy enrolladas y, por lo tanto, no se expresan. De hecho, el medio ambiente puede afectar qué genes se activan o desactivan (consulte el ensayo sobre cuestiones medioambientales, Medio ambiente y epigenética).

Regulación de la transcripción de genes

Algunas regiones de ADN regulan la actividad de otras regiones. Como hemos visto, un promotor es una secuencia específica de ADN que se ubica adyacente al gen que regula. Cuando las proteínas reguladoras llamadas factores de transcripción se unen a un promotor, la ARN polimerasa puede unirse al promotor, que comienza la transcripción de los genes regulados.

Los factores de transcripción también pueden unirse a potenciadores, segmentos de ADN que aumentan la tasa de transcripción de ciertos genes y, por lo tanto, la cantidad de una proteína específica que se produce. Los potenciadores también especifican el momento de la expresión y la respuesta de un gen a señales externas y señales de desarrollo que afectan la expresión génica.

Tal vez recuerde del capítulo 10 que una de las formas en que ciertas hormonas provocan sus efectos es activando genes específicos. Las hormonas esteroides, por ejemplo, se unen a receptores dentro de una célula diana. El complejo hormona-receptor luego encuentra su camino hacia la cromatina en el núcleo y activa genes específicos. Por ejemplo, uno de esos complejos activa los genes de las células que producen el vello facial, lo que explica por qué su padre puede tener barba, pero su madre probablemente no la tiene, a pesar de que tiene los genes necesarios para que le crezca una. En este caso, la hormona sexual testosterona se une a un receptor y activa los genes productores de cabello. Las células del folículo del vello facial de hombres y mujeres tienen los receptores de testosterona necesarios. Sin embargo, las mujeres generalmente no producen suficiente testosterona para activar los genes productores de cabello, por lo que las mujeres con barba son raras.

¿Por qué las atletas que se inyectan testosterona para estimular el desarrollo muscular a veces desarrollan un aumento del vello facial?

Medio ambiente y epigenética

Su estilo de vida puede influir en la salud de su bisnieto. ¿Cómo es esto posible? Puede ocurrir a través de la epigenética, que implica una alteración estable en la expresión génica sin cambios en la secuencia del ADN. En otras palabras, regula cómo se expresan los genes sin cambiar las proteínas que codifican. Consideraremos dos procesos epigenéticos: metilación del ADN y acetilación de histonas. Estos procesos alteran la expresión génica al afectar el empaquetado de la molécula de ADN. El ADN está empaquetado con proteínas para formar cromosomas. La metilación del ADN (agregar un grupo metilo a las bases de citosina en el ADN) apaga la actividad de un gen al incorporar proteínas que actúan para compactar el ADN en una forma más compacta. Por otro lado, la acetilación de histonas hace que el ADN esté menos enrollado y la expresión génica sea más fácil.

Ahora sabemos que estos procesos pueden verse afectados por el medio ambiente y que el patrón de metilación del ADN es dinámico y cambia con el tiempo. Los patrones de metilación del ADN pueden verse afectados por factores ambientales, causar enfermedades, transmitirse de generación en generación y, potencialmente, influir en la evolución. El ADN es sensible al medio ambiente, por lo que lo que comemos y los productos químicos a los que estamos expuestos, incluidos los pesticidas, el humo del tabaco, las hormonas y los nutrientes, pueden influir en nuestra salud al afectar nuestros patrones de expresión genética. Por ejemplo, la nutrición materna durante el embarazo puede provocar cambios epigenéticos en la actividad genética del feto que pueden aumentar la susceptibilidad a la obesidad, la diabetes tipo 2, las enfermedades cardíacas y el cáncer. La cantidad de alimentos consumidos durante el embarazo altera la susceptibilidad de la descendencia a las enfermedades cardiovasculares. También se cree que la epigenética desempeña un papel en los trastornos del comportamiento humano, como los trastornos del espectro autista (que se tratan en el capítulo 18a), el síndrome de Rett (un trastorno del desarrollo que afecta el sistema nervioso) y el síndrome del X frágil (una forma hereditaria de deterioro mental). ). Por ejemplo, existe alguna evidencia de que un gen necesario para responder a la oxitocina (una hormona importante en los vínculos sociales) está desactivado en algunas personas con autismo. Como veremos en el capítulo 21a, el desarrollo del cáncer está controlado por genes inhibidores y promotores del cáncer. Si los genes que inhiben el cáncer se desactivan o los genes que promueven el cáncer se activan, puede resultar en cáncer. Los cambios en el patrón de expresión genética se encuentran en los cánceres de cuello uterino, próstata, mama, estómago y colon.

Aunque se considera que los patrones de metilación del ADN son estables, algunos estudios sugieren que la metilación se puede revertir en la edad adulta. Los alimentos como el brócoli, la cebolla y el ajo pueden reducir la metilación, lo que permite que se expresen los genes. Los investigadores están buscando activamente medicamentos que alteren el patrón de metilación y curen el cáncer.

• ¿Crees que la epigenética aumenta o disminuye la responsabilidad de una persona por su propio comportamiento?

• Es posible que algún día los investigadores desarrollen una “dieta epigenética” que favorezca cambios positivos en la actividad genética. ¿Seguirías esa dieta? ¿Cree que se debería exigir a las mujeres embarazadas que sigan esa dieta?

Ingeniería genética

La manipulación de material genético para fines humanos, una práctica llamada ingeniería genética, comenzó casi tan pronto como los científicos comenzaron a comprender el lenguaje del ADN. La ingeniería genética es parte del esfuerzo más amplio de la biotecnología, un campo en el que los científicos hacen un uso controlado de células vivas para realizar tareas específicas. La ingeniería genética se ha utilizado para producir fármacos y hormonas, mejorar el diagnóstico y el tratamiento de enfermedades humanas, aumentar la producción de alimentos a partir de plantas y animales y conocer los procesos de crecimiento de las células.

La idea básica detrás de la ingeniería genética es poner un gen de interés, en otras palabras, uno que produzca una proteína o rasgo útil, en otro fragmento de ADN para crear ADN recombinante, que es ADN combinado de dos o más fuentes. El ADN recombinante, que lleva el gen de interés, se coloca luego en una célula que se multiplica rápidamente y que rápidamente produce muchas copias del gen. La cosecha final puede consistir en grandes cantidades del producto genético o muchas copias del propio gen. Echemos un vistazo más de cerca al procedimiento paso a paso.

1. El gen de interés se extrae de su organismo original y se empalma en el ADN del vector. Tanto el ADN que contiene originalmente el gen de interés como el ADN del vector, que recibe los genes transferidos y los transporta a una nueva célula, se cortan en secuencias específicas que son reconocidas por una enzima de restricción. Este es un tipo de enzima que hace un corte escalonado entre pares de bases específicos en el ADN, dejando varias bases sin aparear a cada lado del corte. Hay muchos tipos de enzimas de restricción, cada tipo reconoce y corta una secuencia diferente de ADN. El tramo de bases no apareadas producidas en cada lado del corte se denomina extremo pegajoso debido a su tendencia a emparejarse con los tramos monocatenarios de secuencias de bases complementarias en los extremos de otras moléculas de ADN que se cortaron con la misma enzima de restricción (Figura 21,13).

FIGURA 21.13. El ADN de diferentes fuentes se puede empalmar usando una enzima de restricción para hacer cortes en el ADN. Una enzima de restricción hace un corte escalonado en una secuencia específica de ADN, dejando una región de bases desaparecidas en cada extremo cortado. La región del ADN de una sola hebra en el extremo cortado se denomina extremo adhesivo, porque tiende a emparejarse con el extremo adhesivo complementario de cualquier otro fragmento de ADN que haya sido cortado con la misma enzima de restricción, incluso si los fragmentos de ADN provienen de diferentes partes del mismo. fuentes.

Los extremos pegajosos son el secreto para empalmar el gen de interés y el ADN del vector. Los extremos pegajosos del ADN de diferentes fuentes serán complementarios y se mantendrán unidos siempre que hayan sido cortados con la misma enzima de restricción. La unión inicial entre los extremos pegajosos es temporal, pero los extremos se pueden pegar juntos de forma permanente por otra enzima, la ADN ligasa. El ADN recombinante resultante contiene ADN de dos fuentes.

2. El vector se utiliza para transferir el gen de interés a una nueva célula huésped. Los portadores biológicos que transportan el ADN recombinante a una célula huésped se denominan vectores. Un vector común son los plásmidos bacterianos, que son pequeñas piezas circulares de ADN autorreplicante que existen por separado del cromosoma bacteriano.2 Como se describió anteriormente, el ADN fuente (es decir, la fuente del gen de interés) y el plásmido ( vector) el ADN se tratan ambos con la misma enzima de restricción. Posteriormente, los fragmentos de ADN fuente, algunos de los cuales contendrán el gen de interés, se incorporarán a los plásmidos cuando se unan sus extremos pegajosos. El ADN recombinante se mezcla con bacterias en un tubo de ensayo. En las condiciones adecuadas, algunas de las células bacterianas absorberán los plásmidos recombinados (Figura 21.14).

FIGURA 21.14. Una descripción general de la ingeniería genética con plásmidos

Aunque la estrategia básica suele ser la misma, existen muchas variaciones sobre el tema del transporte de un gen a un nuevo huésped. Por ejemplo, el gen de interés a veces se combina con ADN viral. Luego, los virus se utilizan como vectores para insertar el ADN recombinante en una célula huésped. También se pueden usar como vectores células distintas de las bacterias, incluidas las células de levadura o animales.

3. El organismo recombinante que contiene el gen de interés se identifica y se aísla de la mezcla de recombinantes. Cuando se utilizan plásmidos como vector de ADN, cada plásmido recombinante se introduce en una sola célula bacteriana y luego cada célula se hace crecer en una colonia. Cada colonia contiene un plásmido recombinante diferente. Las bacterias que contienen el gen de interés deben identificarse y aislarse.

4. El gen se amplifica mediante clonación bacteriana o mediante el uso de una reacción en cadena de la polimerasa. Una vez que se ha identificado la colonia que contiene el gen de interés, los investigadores generalmente amplifican (es decir, replican) el gen, produciendo numerosas copias. La amplificación de genes se logra usando una de dos técnicas: clonación bacteriana o reacción en cadena de la polimerasa.

Clonación . Las bacterias que contienen el plásmido con el gen de interés se pueden cultivar en grandes cantidades mediante clonación. Cada bacteria se divide muchas veces para formar una colonia. Así, cada colonia constituye un clon, un grupo de organismos genéticamente idénticos, todos descendientes de una sola célula. En este caso, todos los miembros del clon portan el mismo ADN recombinante. Posteriormente, los plásmidos se pueden separar de las bacterias, proceso que purifica parcialmente el gen de interés. Luego, los plásmidos pueden ser absorbidos por otras bacterias que, por lo tanto, serán capaces de realizar un servicio que los humanos consideren útil. Alternativamente, los plásmidos se pueden transferir a células vegetales o animales, creando organismos transgénicos, organismos que contienen genes de otras especies.

Reacción en cadena de la polimerasa (PCR). En PSR (Figura 21.15), el ADN de interés se descomprime, mediante calentamiento suave, para romper los enlaces de hidrógeno y formar hebras simples.Las hebras simples, que servirán como plantillas, se mezclan con cebadores (piezas cortas especiales de ácido nucleico), un cebador con bases complementarias para cada hebra. Los cebadores sirven como etiquetas de inicio para la replicación del ADN. También se agregan a la mezcla nucleótidos y una ADN polimerasa especial resistente al calor, que promueve la replicación del ADN, que luego se enfría para permitir el emparejamiento de bases. A través del emparejamiento de bases, se forma una hebra complementaria para cada hebra. Luego, el procedimiento se repite muchas veces y cada vez se duplica el número de copias del ADN de interés. De esta forma, se pueden producir miles de millones de copias del ADN de interés en poco tiempo.

FIGURA 21.15. La reacción en cadena de la polimerasa (PCR) produce rápidamente una multitud de copias de un solo gen o de cualquier segmento deseado de ADN. La PCR amplifica el ADN más rápidamente que la clonación bacteriana. Tiene muchos usos además de la ingeniería genética, incluida la toma de huellas dactilares de ADN.

La ingeniería genética implica alterar los genes de un organismo, agregando nuevos genes y rasgos a microbios, plantas o incluso animales. ¿Crees que tenemos derecho a "jugar a ser Dios" y alterar las formas de vida de esta manera? La Corte Suprema de los Estados Unidos ha aprobado el patentamiento de organismos modificados genéticamente, primero de microbios y ahora de mamíferos como los cerdos que son modificados genéticamente para su uso en trasplantes de órganos. Si se le pidiera que decidiera si es ético patentar una nueva forma de vida, ¿cómo respondería?

Aplicaciones de la ingeniería genética

La ingeniería genética se ha utilizado de dos formas generales.

• La ingeniería genética proporciona una forma de producir grandes cantidades de un producto genético en particular. El gen útil se transfiere a otra célula, generalmente una bacteria o una célula de levadura, que se puede cultivar fácilmente en grandes cantidades. Las células se cultivan en condiciones que hacen que expresen el gen, después de lo cual se recolecta el producto del gen. Por ejemplo, se han utilizado bacterias modificadas genéticamente para producir grandes cantidades de hormona del crecimiento humana (Figura 21.16). El tratamiento con hormona del crecimiento permite que los niños con una glándula pituitaria hipoactiva crezcan hasta alcanzar una estatura casi normal.

• La ingeniería genética permite que un gen de un rasgo considerado útil por los seres humanos se tome de una especie y se transfiera a otra especie. El organismo transgénico luego exhibe el rasgo deseado. Por ejemplo, los científicos han dotado al salmón con un gen de un pez parecido a una anguila. Este gen hace que el salmón produzca hormona del crecimiento durante todo el año (algo que normalmente no hace). Como resultado, el salmón crece más rápido de lo normal.

FIGURA 21.16. La ingeniería genética se utiliza para producir grandes cantidades de una proteína deseada o para crear un organismo con un rasgo deseado. Este niño tiene una glándula pituitaria hipoactiva. Su subsecreción de hormona del crecimiento habría provocado que fuera muy bajo, incluso de adulto. Sin embargo, la hormona del crecimiento de bacterias modificadas genéticamente le ha ayudado a crecer a una altura casi normal.

Aplicaciones medioambientales . La ingeniería genética también tiene aplicaciones medioambientales. Por ejemplo, en las plantas de tratamiento de aguas residuales, los microbios modificados genéticamente reducen la cantidad de fosfato y nitrato que se descargan en las vías fluviales. El fosfato y el nitrato pueden provocar un crecimiento excesivo de las plantas acuáticas, que podrían obstruir los cursos de agua y las presas, y de las algas, que pueden producir sustancias químicas venenosas para los peces y el ganado. Los microorganismos también están siendo modificados genéticamente para modificar o destruir desechos químicos o contaminantes para que ya no sean dañinos para el medio ambiente. Por ejemplo, los microbios que comen petróleo que pueden resistir las altas concentraciones de sal y las bajas temperaturas de los océanos han demostrado ser útiles para limpiar después de los derrames de petróleo marino.

Ganado . La ingeniería genética también se ha utilizado en ganado. Se han creado vacunas diseñadas genéticamente para proteger a los lechones contra una forma de disentería llamada diarrea, las ovejas contra la podredumbre y el sarampión, y los pollos contra la enfermedad de la bursitis (una enfermedad viral que a menudo es fatal). Las bacterias genéticamente modificadas producen somatotropina bovina (BST), una hormona producida naturalmente por la glándula pituitaria de la vaca que mejora la producción de leche. Las inyecciones de BST pueden aumentar la producción de leche en casi un 25%.

Los animales transgénicos se han creado inyectando un óvulo fertilizado con el gen de interés en una placa de Petri. Los objetivos de crear animales transgénicos incluyen hacer animales con carne más magra, ovejas con lana más suave, vacas que producen más leche y animales que maduran más rápidamente.

Productos farmacéuticos . Se han introducido genes en una variedad de células, desde microbios hasta mamíferos, para producir proteínas para el tratamiento de alergias, cáncer, ataques cardíacos, trastornos sanguíneos, enfermedades autoinmunes e infecciones.

También se han utilizado bacterias modificadas genéticamente para crear vacunas para humanos. Tal vez recuerde del Capítulo 13 que una vacuna generalmente usa una bacteria o virus inactivado para estimular la respuesta inmune del cuerpo a la forma activa del organismo. La idea es que el cuerpo aprenda a reconocer las proteínas en la superficie del organismo infeccioso y monte defensas contra cualquier organismo que tenga esas proteínas. Debido a que el organismo utilizado en la vacuna se volvió inofensivo, la vacuna no puede desencadenar una infección. Los científicos producen vacunas modificadas genéticamente al poner en bacterias el gen que codifica la proteína de la superficie del organismo infeccioso. Luego, las bacterias producen grandes cantidades de esa proteína, que puede purificarse y usarse como vacuna. La vacuna no puede causar infección, porque solo se usa la proteína de superficie en lugar del propio organismo infeccioso.

También se han utilizado plantas para producir proteínas terapéuticas. Los plátanos modificados que producen una forma alterada de la proteína de superficie del virus de la hepatitis B se están desarrollando como una vacuna comestible contra la enfermedad hepática de la hepatitis B. Algún día, es posible que coma un plátano para vacunarse, en lugar de recibir una inyección contra la hepatitis B. También se están diseñando plantas para producir "planticuerpos", anticuerpos fabricados por plantas. Por ejemplo, se cultivan semillas de soja que contienen anticuerpos humanos contra el virus del herpes simple que causa el herpes genital. Se ha trasplantado al maíz un gen humano para un anticuerpo que se une a las células tumorales. Luego, los anticuerpos pueden entregar radioisótopos a las células cancerosas, matándolas selectivamente.

Pharming es una palabra que proviene de la combinación de las palabras agricultura y productos farmacéuticos. En la farmacia genética, se crean animales transgénicos que producen una proteína con valor medicinal en su leche, huevos o sangre. Luego, la proteína se recolecta y purifica para su uso como producto farmacéutico. Cuando el animal farmacéutico es un mamífero, el gen se expresa en las glándulas mamarias. Luego, la proteína deseada se extrae y se purifica de la leche (Figura 21.17). Por ejemplo, el gen de la proteína alfa-1-antitripsina (AAT) se ha insertado en ovejas que luego secretan AAT en la leche. Las personas con una forma hereditaria y potencialmente mortal de enfisema (una enfermedad pulmonar) toman AAT como fármaco. También se está probando como fármaco para prevenir el daño pulmonar en personas con fibrosis quística. El primer fármaco elaborado a partir de la leche de una cabra transgenética fue un fármaco anticoagulante llamado ATryn. Se administra a personas con una deficiencia de la coagulación de la sangre cuando deben someterse a una cirugía. Los investigadores también han creado una cabra transgénica para producir leche que contiene lisozima, un agente antibacteriano. La lisozima se puede utilizar para tratar infecciones intestinales que matan a millones de niños en países subdesarrollados.

FIGURA 21.17. El procedimiento para crear un animal transgénico que producirá una proteína útil en su leche.

Materias primas . La ingeniería genética también se utiliza para producir nuevas materias primas útiles. Por ejemplo, la seda de araña es cinco veces más resistente que el acero y sigue siendo ligera. Se han hecho intentos de cultivar arañas por su seda, pero las arañas son demasiado agresivas para vivir juntas. Las cabras han sido modificadas genéticamente para poseer el gen de la seda de araña y secretar proteínas de la seda de araña en su leche (Figura 21.18). Más recientemente, la bacteria E. coli ha sido modificada genéticamente para producir proteínas de seda de araña. Las proteínas de la seda de araña se pueden hilar en un hilo fino, que podría usarse para ropa a prueba de balas, hilo quirúrgico más delgado y autos y aviones de carreras más fuertes pero más livianos.

FIGURA 21.18. Esta cabra transgénica tiene el gen para producir seda de araña, una de las sustancias más fuertes que se conocen. La proteína de la seda de araña puede extraerse de la leche de cabra y hilarse en hilos que se pueden utilizar para productos en los que la resistencia y el peso ligero son cualidades importantes.

Agricultura . La mayoría de nosotros experimenta algunos de los resultados de la ingeniería genética en nuestras mesas (ver Ensayo sobre temas de salud, Alimentos genéticamente modificados). Los rasgos más comunes que se han modificado genéticamente en los cultivos son la resistencia a las plagas y la resistencia a los herbicidas. Los científicos también han desarrollado dos cepas de papaya resistentes a virus y las han distribuido a los productores de papaya en Hawai, salvando a la industria de la ruina. Además, se han modificado genéticamente diferentes cepas de arroz para resistir las bacterias que causan enfermedades y para resistir las inundaciones del arrozal. Otras plantas han sido modificadas genéticamente para ser más nutritivas. Por ejemplo, el arroz dorado es una variedad de arroz que ha sido modificada genéticamente para producir altos niveles de betacaroteno, un precursor de la vitamina A, que escasea en ciertas partes del mundo. Más de 100 millones de niños en todo el mundo padecen deficiencia de vitamina A, y 500.000 de ellos quedan ciegos cada año debido a esa deficiencia. Aunque el arroz dorado no puede suministrar una dosis diaria recomendada completa de vitamina A, la cantidad que contiene podría ser útil para una persona cuya dieta es muy baja en vitamina A. También se han creado otros cultivos que crecen más rápido, producen mayores rendimientos y tienen más vida útil.

Los problemas asociados con muchas enfermedades genéticas surgen porque un gen mutante no produce un producto proteico normal. El objetivo de la terapia génica es curar enfermedades genéticas colocando genes funcionales normales en las células del cuerpo que fueron afectadas por el gen mutante. El gen funcional produciría entonces la proteína necesaria.

Métodos para transmitir un gen sano . Una forma de transferir un gen sano a una célula diana es mediante virus. Los virus generalmente atacan solo un tipo de célula. Por ejemplo, un adenovirus, que causa el resfriado común, generalmente ataca las células del sistema respiratorio. Un virus se compone principalmente de material genético, comúnmente ADN, rodeado por una capa de proteína (véase el capítulo 13a). Una vez dentro de una célula, el ADN viral utiliza la maquinaria metabólica de la célula para producir proteínas virales. Si un gen sano se empalma en el ADN de un virus que primero se ha vuelto inofensivo, el virus entregará el gen sano a la célula huésped y provocará la producción del producto génico deseado (Figura 21.19).

Otro tipo de virus utilizado en la terapia génica es un retrovirus, un virus cuya información genética se almacena como ARN en lugar de ADN. Una vez dentro de la célula diana, un retrovirus reescribe su información genética como ADN de doble hebra e inserta el ADN viral en un cromosoma de la célula diana.

FIGURA 21.19. Terapia genética con virus. En la terapia génica, se introduce un gen sano en un paciente que tiene una enfermedad genética causada por un gen defectuoso.

Comida genéticamente modificada

Desde las mesas de la cena hasta los círculos diplomáticos, la gente está discutiendo sobre alimentos genéticamente modificados (GM). Este interés relativamente reciente es algo irónico, considerando que la gente en los Estados Unidos ha estado comiendo alimentos transgénicos desde mediados de la década de 1990. Más del 70% de los alimentos procesados ​​vendidos en los Estados Unidos contienen ingredientes modificados genéticamente. Sin embargo, muchas personas se oponen con vehemencia a los alimentos transgénicos.

¿Por qué algo tan común como los alimentos transgénicos es controvertido? Las preocupaciones al respecto generalmente se pueden dividir en tres categorías: problemas de salud, problemas sociales y problemas ambientales. Exploremos estas categorías una a la vez.

Un panel de la Academia Nacional de Ciencias (NAS) ha publicado un informe que dice que los cultivos transgénicos no presentan riesgos para la salud que no puedan ser causados ​​también por cultivos creados por mejoramiento convencional. Sin embargo, debido a que la ingeniería genética podría producir cambios dañinos no deseados en los alimentos, el panel de la NAS recomienda un escrutinio de los alimentos transgénicos antes de que puedan comercializarse. Actualmente, el Departamento de Agricultura de EE. UU., La Administración de Alimentos y Medicamentos (FDA) y la Agencia de Protección Ambiental regulan los alimentos modificados genéticamente. El panel de la NAS concluyó que los alimentos transgénicos que ya están en el mercado son seguros.

· El salmón más grande en la parte posterior de la foto ha sido modificado genéticamente para crecer más rápido que el salmón normal al frente.

Una preocupación de seguridad común es que los alimentos transgénicos pueden contener alérgenos (sustancias que causan alergias). Una vez que se produce una proteína, la célula la modifica de varias formas. La proteína puede modificarse en la planta genéticamente modificada de forma diferente a como lo haría en una célula no modificada, y la modificación podría producir un alérgeno. La probabilidad de que esto pueda ocurrir se reduce mediante pruebas rigurosas. La mayoría de los alérgenos conocidos comparten ciertas propiedades. Son proteínas, moléculas relativamente pequeñas y resistentes al calor, el ácido y la digestión en el estómago. Si una proteína producida por una planta transgénica tiene alguna de las propiedades típicas de un alérgeno o es estructuralmente similar a un alérgeno conocido, la FDA lo considera un alérgeno potencial y requiere que la proteína se someta a pruebas de alergia adicionales.

Es probable que la resistencia bacteriana a los antibióticos sea una gran amenaza para la salud pública en esta década (ver Capítulo 13a). Cuando las bacterias son resistentes a un antibiótico, el fármaco no las matará y, por lo tanto, ya no curará la enfermedad humana que las causa. Algunas personas se preocupan por la práctica científica de poner genes de resistencia a un antibiótico en cultivos transgénicos como marcadores para identificar las plantas con los genes modificados. Las plántulas de plantas que se cree están modificadas genéticamente se cultivan en el laboratorio en presencia de un antibiótico. Solo sobrevivirán las plántulas con el gen de la resistencia. Debido a la forma en que fueron diseñadas, las plantas supervivientes también contienen el gen "útil".

Lo que preocupa a algunas personas es que los genes de resistencia a los antibióticos podrían transferirse a las bacterias, haciendo que las bacterias sean resistentes a los antibióticos. Las bacterias receptoras pueden ser las que normalmente viven en el sistema digestivo humano o pueden ser bacterias ingeridas con los alimentos. No se sabe si los genes se pueden transferir de una planta a una bacteria. Sin embargo, se sabe que las bacterias pueden transferir de forma fácil y rápida genes de resistencia a los antibióticos entre sí. Por lo tanto, una bacteria inofensiva en el intestino podría transferir el gen de resistencia a los antibióticos a una bacteria que causa la enfermedad.

La transferencia de genes de resistencia a los antibióticos de plantas modificadas genéticamente a bacterias podría tener graves consecuencias. Por esta razón, los genes marcadores de resistencia a los antibióticos se están eliminando gradualmente en favor de otros genes marcadores, como una proteína verde fluorescente. Los científicos también han desarrollado una forma de inactivar el gen de resistencia a los antibióticos si se transfiriera a las bacterias.

Los defensores de los alimentos transgénicos argumentan que los cultivos resistentes a herbicidas y pesticidas reducen la necesidad de fumigar con herbicidas y pesticidas. Hasta ahora, la experiencia ha demostrado que la validez de este argumento depende del cultivo. El algodón resistente a las plagas ha reducido sustancialmente el uso de pesticidas, pero probablemente el maíz resistente a las plagas no lo ha hecho. Los agricultores que cultivan cultivos resistentes a los herbicidas aún rocían con herbicidas, pero cambian el tipo de herbicida que usan por uno que sea menos dañino para los animales.

Desafortunadamente, los cultivos modificados genéticamente que contienen insecticidas podrían tener efectos indeseables sobre los insectos. La ingeniería genética de insecticidas en plantas podría acelerar el desarrollo de la resistencia de los insectos a ese insecticida, haciendo que el insecticida sea ineficaz, no solo para el cultivo genéticamente modificado, sino para todos los cultivos.

Otra preocupación es que los organismos modificados genéticamente podrían dañar a otros organismos. Un ejemplo es que se ha demostrado que el polen del maíz resistente a las plagas daña a las orugas de la mariposa monarca. Afortunadamente, las orugas monarca rara vez encuentran suficiente polen para ser dañadas, y la mayoría del maíz resistente a las plagas que se cultiva en los Estados Unidos hoy en día no produce polen que sea dañino para las mariposas monarca. Un segundo ejemplo de un organismo modificado genéticamente que tiene el potencial de dañar a otros organismos es el salmón que produce más hormona del crecimiento y crece varias veces más rápido que sus parientes silvestres. Estos salmones se cultivan en piscifactorías. Si la FDA otorga la aprobación, el salmón alterado genéticamente podría reducir drásticamente los costos para los piscicultores y consumidores. Sin embargo, cuando el salmón modificado genéticamente se cultiva en tanques con salmón común y la comida es escasa, el salmón modificado genéticamente se come la mayor parte de la comida y algunos de sus compañeros ordinarios. ¿Qué pasaría si el salmón modificado genéticamente se escapara de sus corrales en la piscifactoría? Pueden aparearse con el salmón salvaje y crear una descendencia menos saludable o competir con el salmón salvaje por la comida, lo que eventualmente podría causar la extinción del salmón salvaje. Es posible escapar. Durante los últimos años, cientos de miles de peces han escapado de las granjas de peces cuando las tormentas o los leones marinos destrozaron los corrales flotantes. Para minimizar el riesgo de que el salmón modificado genéticamente pueda destruir la población de salmón salvaje, los científicos planean criar los peces tierra adentro, esterilizar a las crías y enviar solo peces estériles a los corrales costeros. El procedimiento de esterilización es eficaz en lotes pequeños de pescado, pero no se sabe si el procedimiento es completamente eficaz en lotes grandes de pescado.

Los críticos de los alimentos transgénicos también temen que los cultivos modificados genéticamente para resistir a los herbicidas puedan convertirse en & quot; supermalezas & quot; que no podrían controlarse con los productos químicos existentes. En Dakota del Norte, a lo largo de las carreteras crecen plantas de canola transgénicas resistentes a los herbicidas. La canola puede hibridar con al menos dos malas hierbas silvestres. Las dos cepas originales de canola transgénica eran cada una resistente a un herbicida diferente. Como resultado de la polinización cruzada, algunas de las plantas de canola que se encuentran en la naturaleza son resistentes a ambos herbicidas, lo que sugiere que los rasgos transgénicos son estables en la naturaleza y están evolucionando.

Los defensores de los alimentos transgénicos afirman que los alimentos transgénicos pueden ayudar en la batalla contra el hambre en el mundo.Hemos visto que la ingeniería genética puede producir cultivos que resistan plagas y enfermedades. También puede producir cultivos con mayores rendimientos y cultivos que crecerán a pesar de la sequía, el suelo agotado o el exceso de sal, aluminio o hierro. Los alimentos también se pueden modificar genéticamente para que contengan mayores cantidades de nutrientes específicos.

Los críticos del uso de alimentos transgénicos para combatir el hambre en el mundo argumentan que el problema del hambre no tiene nada que ver con la incapacidad de producir suficientes alimentos. El problema, dicen, es social de distribuir alimentos para que estén disponibles para las personas que los necesitan.

Algunos países en desarrollo se resisten al uso de semillas transgénicas. Parte de la resistencia se debe a problemas de salud persistentes. Sin embargo, muchos agricultores de los países en desarrollo también se oponen a las semillas transgénicas porque las plantas transgénicas no se siembran por sí mismas. La necesidad de comprar semillas cada año supone una carga económica para los agricultores pobres.

• ¿Considera que los alimentos transgénicos son una bendición o un peligro para el mundo? Cuales son tus razones?

• Si un organismo modificado genéticamente que fue creado para la alimentación comienza a causar problemas ambientales, ¿quién debe rendir cuentas?

• ¿Cree que los alimentos que contienen componentes modificados genéticamente deberían etiquetarse como tales?

Resultados de la terapia genética . Más de 4000 enfermedades humanas se han atribuido a defectos en genes individuales. Aunque la Administración de Alimentos y Medicamentos aún no ha aprobado una terapia génica para ninguna de estas afecciones, actualmente se están llevando a cabo cientos de ensayos clínicos de terapias génicas, incluidos ensayos de posibles terapias para la fibrosis quística y el cáncer (discutido en el Capítulo 21a).

La primera afección que se trató experimentalmente con terapia génica fue un trastorno conocido como enfermedad de inmunodeficiencia combinada grave (SCID). El sistema inmunológico de los niños con SCID no funciona, dejándolos vulnerables a las infecciones. La causa del problema es un gen mutante que impide la producción de una enzima llamada adenosina desaminasa (ADA). Sin ADA, los glóbulos blancos nunca maduran, mueren mientras aún se desarrollan en la médula ósea. El primer ensayo de terapia génica comenzó en 1990, cuando los glóbulos blancos de una paciente con SCID de 4 años, Ashanthi DeSilva, fueron modificados genéticamente para portar el gen ADA y luego regresaron a su diminuto cuerpo. Sus propios glóbulos blancos alterados genéticamente comenzaron a producir ADA y los mecanismos de defensa de su cuerpo se fortalecieron. La vida de Ashanthi comenzó a cambiar. No estaba tan enferma como antes. Ella podría jugar con otros niños. Sin embargo, la vida útil de los glóbulos blancos se mide en semanas, y cuando el número de células con alteraciones genéticas disminuyó, hubo que infundir nuevas células con alteraciones genéticas. Ashanthi tiene ahora veinte años y un sistema inmunológico razonablemente saludable. Sin embargo, todavía necesita tratamientos repetidos.

Los científicos franceses creen que han curado a 10 niños con X-SCID mediante el uso de terapia génica (Figura 21.20). X-SCID es un síndrome de inmunodeficiencia combinado grave causado por un gen mutante en el cromosoma X. Todavía es demasiado pronto para saber con certeza si los 10 niños necesitarán tratamiento en el futuro. Sin embargo, cuatro niños en los estudios franceses que habían mostrado una mejoría en los síntomas de X-SCID desarrollaron leucemia debido a la terapia.

FIGURA 21.20. Rhys Evans es la primera persona que se cura de la enfermedad de inmunodeficiencia combinada grave ligada al cromosoma X (X-SCID) mediante terapia génica. El sistema inmunológico de una persona con X-SCID no funciona. El sistema inmunológico de Rhys Evans se fortaleció y ahora puede ir a lugares públicos sin temer el contacto con personas que puedan ser portadoras de gérmenes. Puede jugar con otros niños.

Recientemente se ha tratado una forma de distrofia muscular con terapia génica. Los investigadores empaquetaron un virus con la forma normal de la proteína que es deficiente en esta forma de distrofia muscular. Luego, el virus se inyectó directamente en los músculos. El nivel de la proteína y la expresión génica de la proteína permanecieron altos durante varios meses, restaurando parte de la función muscular de los pacientes.

Sin tratamiento, los niños con X-SCID mueren a una edad temprana. El tratamiento de terapia génica para X-SCID que causó leucemia en cuatro niños franceses parece haber curado este trastorno mortal en otros pacientes. Si tuviera un hijo con X-SCID, ¿le gustaría que se sometiera a este tratamiento de terapia génica? ¿Por qué o por qué no? ¿Qué factores consideraría al tomar su decisión?

Un genoma es el conjunto completo de genes que lleva un miembro de una especie, en nuestro caso, una persona. La genómica es el estudio de genomas completos y las interacciones de los genes entre sí y con el medio ambiente.

Uno de los objetivos de la genómica es determinar la ubicación y las secuencias de los genes. Los investigadores han desarrollado supercomputadoras que secuencian automáticamente (determinan el orden de las bases en) el ADN. Las supercomputadoras se utilizaron a gran escala en el Proyecto Genoma Humano, un esfuerzo de investigación mundial, completado en 2003, para secuenciar el genoma humano. Como resultado, ahora tenemos una idea de la ubicación de los genes a lo largo de los 23 pares de cromosomas humanos y la secuencia de los 3 mil millones de pares de bases estimados que componen esos cromosomas. Aunque el número exacto de genes humanos aún no se conoce con certeza, los científicos ahora estiman que el genoma humano consta de 20.000 a 25.000 genes, no 100.000 como se pensaba originalmente. Una de las razones del menor número de genes reales es que muchas familias de genes tienen funciones relacionadas o redundantes y, por lo tanto, pueden compartir ciertos genes, por lo que se necesitan menos para llevar a cabo todas las funciones del cuerpo. Una segunda razón es que ahora se sabe que muchos genes codifican partes de más de una proteína.

Además, los investigadores han identificado y mapeado ubicaciones específicas en genes de cromosomas específicos para más de 1400 enfermedades genéticas. Se espera que esta información dé a los científicos una mayor capacidad para diagnosticar, analizar y eventualmente tratar muchas de las 4000 enfermedades humanas que tienen una base genética conocida. Los investigadores ya han clonado los genes responsables de muchas enfermedades genéticas, incluida la distrofia muscular de Duchenne, el retinoblastoma, la fibrosis quística y la neurofibromatosis. Estos genes aislados ahora se pueden usar para probar la presencia de los mismos genes que causan enfermedades en individuos específicos. Como vimos en el Capítulo 20, algunas pruebas genéticas se pueden usar para identificar a las personas que son portadoras de ciertas enfermedades genéticas como la fibrosis quística, lo que permite a las familias tomar decisiones basadas en las probabilidades conocidas de tener un hijo afectado Se pueden usar pruebas similares para el diagnóstico prenatal y para el diagnóstico antes de que comiencen los síntomas de la enfermedad. Una vez que se ha identificado un gen relacionado con una enfermedad, los científicos pueden estudiarlo para aprender más sobre la proteína que codifica y quizás descubrir formas de corregir el problema.

También hemos aprendido del Proyecto Genoma Humano que los humanos son idénticos en el 99,9% de las secuencias de sus genes. A medida que los científicos comprendan mejor el 0.1% del ADN que difiere de una persona a otra, esperan aprender más sobre por qué algunas personas desarrollan enfermedades cardíacas, cáncer o enfermedad de Alzheimer y otras no.

Un segundo objetivo de la genómica es comprender los mecanismos que controlan la expresión génica. Más del 95% del ADN humano no codifica proteínas; sin embargo, algunas de estas secuencias de ADN no codificantes funcionan como regiones reguladoras que determinan cuándo, dónde y qué cantidad de ciertas proteínas se producen. Debido a que la actividad genética juega un papel en muchas enfermedades, el estudio de cómo estas regiones activan o desactivan los genes puede conducir a avances en el diagnóstico y el tratamiento.

Una de las herramientas que los investigadores utilizan en este esfuerzo es el microarray, que consta de miles de secuencias de ADN estampadas en un solo portaobjetos de vidrio llamado chip de ADN. Los investigadores usan microarrays para monitorear una gran cantidad de segmentos de ADN para descubrir qué genes están activos y cuáles se desactivan en diferentes condiciones, como en diferentes tipos de tejidos, diferentes etapas de desarrollo o en la salud y la enfermedad. Por ejemplo, pueden usar micromatrices para identificar genes que están activos en células cancerosas pero no en células sanas (Figura 21.21). Presumiblemente, los genes que están activos en las células cancerosas juegan un papel en el desarrollo del cáncer.

FIGURA 21.21. Una comparación de microarrays que muestran el patrón de actividad genética en el cáncer de próstata y en el tejido normal. Los genes que están activos en el tejido con cáncer de próstata pero no en el tejido normal probablemente juegan un papel en el desarrollo del cáncer.

Además de identificar la actividad genética en la salud y la enfermedad, el análisis de microarrays es útil para identificar la variación genética en los miembros de una población. Algunas de estas diferencias genéticas se encuentran en forma de polimorfismos de un solo nucleótido (SNP o snips). Estas son secuencias de ADN que pueden variar en un nucleótido de una persona a otra, y se cree que las diferencias en sus productos proteicos influyen en cómo respondemos al estrés y las enfermedades, entre otras cosas. A medida que los investigadores aprendan más sobre los SNP, es posible que puedan desarrollar tratamientos adaptados a la composición genética de cada individuo. Estos son los tipos de descubrimientos que pueden abrir la puerta a la terapia génica. Si bien la terapia génica individualizada puede ser útil en el futuro, ya utilizamos la identificación de diferencias individuales en el ADN de forma regular en la toma de huellas dactilares de ADN (consulte el ensayo sobre cuestiones éticas, ciencia forense, ADN y privacidad personal).

A algunas personas les preocupa que una vez que sepamos la ubicación y función de cada gen y hayamos perfeccionado las técnicas de la terapia génica, ya no limitaremos la manipulación genética a reparar genes defectuosos, sino que comenzaremos a modificar genes para mejorar las capacidades humanas. ¿Debería permitirse a las personas diseñar a sus bebés eligiendo genes que consideren superiores? ¿Qué piensas? ¿Dónde debería dibujarse la línea? ¿Quién debería trazar esa línea? ¿Quién debería decidir qué genes son "buenos"?

Cuando los SNP están ubicados uno cerca del otro en un cromosoma, tienden a heredarse juntos. Un grupo de SNP en una región de un cromosoma se llama haplotipo. El Proyecto Internacional HapMap es un consorcio científico cuyo propósito es describir la variación genética entre poblaciones. Los investigadores que colaboran en este proyecto comparan las frecuencias de haplotipos en grupos de personas que tienen una determinada enfermedad con las de un grupo sin la enfermedad, con la esperanza de identificar genes asociados con la enfermedad.

Comparación de genomas de diferentes especies

También se ha cartografiado el ADN de ciertos organismos ampliamente estudiados, incluidos el ratón, la mosca de la fruta, un gusano redondo, la levadura, el moho mucoso y la abeja melífera. A partir de estos genomas, los genetistas esperan obtener información sobre la biología básica, incluidos los principios básicos de la organización de los genes dentro del genoma, la regulación de los genes y la evolución molecular. Los humanos comparten muchos genes con otros organismos. Por ejemplo, compartimos el 50% de nuestros genes con la mosca de la fruta y el 90% de nuestros genes con el ratón. Estas similitudes genéticas son evidencia de nuestro pasado evolutivo común. Es probable que los genes y los mecanismos genéticos que compartimos con otros organismos sean importantes para determinar la forma del cuerpo, así como para influir en el desarrollo y el envejecimiento.

En el capítulo 19, aprendimos sobre el ciclo celular. En los capítulos 20 y 21, aprendimos sobre los genes, su herencia y su regulación, y también consideramos cómo las mutaciones afectan las funciones de los genes. En el Capítulo 21a, usamos esta información para comprender el cáncer, una familia de enfermedades en las que las mutaciones en los genes que regulan el ciclo celular provocan una pérdida de control sobre la división celular.

Ciencia forense, ADN y privacidad personal

Las llamadas huellas dactilares de ADN, como las huellas más convencionales que dejan los dedos, pueden ayudar a identificar a los individuos a los que pertenecen entre una gran población. La toma de huellas dactilares de ADN se refiere a técnicas de identificación de individuos sobre la base de características únicas de su ADN. Las huellas dactilares de ADN son posibles porque muchas regiones de ADN están compuestas de pequeñas secuencias específicas de ADN que se repiten muchas veces. Los más utilizados son las unidades repetidas de 1 a 5 bases, que se denominan repeticiones cortas en tándem (STR). El número de veces que se repiten estas secuencias varía considerablemente de una persona a otra, desde unas pocas hasta 100 repeticiones. Debido a estas diferencias, los segmentos se pueden usar para hacer coincidir una muestra de ADN con la persona cuyas células produjeron la muestra.

El primer paso para preparar una huella de ADN es extraer ADN de una muestra de tejido. El tipo de tejido no importa, y un tipo de tejido se puede comparar con éxito con otro tipo. Las fuentes de uso común incluyen sangre, semen, piel y folículos pilosos, porque no son demasiado dolorosos para eliminarlos, están fácilmente disponibles o se dejan en la escena del crimen.

En primer lugar, la cantidad de ADN aumenta considerablemente con la PCR, como se describe en la Figura 21.15. Los cebadores utilizados son específicos de secuencia para las regiones a cada lado de la región repetida. Esto produce muchas copias de la región repetida, que luego se analizan para determinar el número de repeticiones presentes.

FIGURA 21.A. El patrón de bandas en una huella de ADN está determinado por la secuencia de bases en el ADN de una persona y, por lo tanto, es único para cada persona. Una coincidencia entre las huellas dactilares de ADN puede identificar la fuente de una muestra de tejido de la escena del crimen con un alto grado de certeza. ¿Qué huella de ADN del sospechoso coincide con esta muestra encontrada en la escena del crimen?

El FBI utiliza 13 STR como un conjunto básico para el análisis forense. La huella de ADN resultante es exclusiva de la persona que produjo el ADN. Además, cualquier muestra de ADN tomada de la misma persona sería siempre idéntica. Pero los perfiles de huellas dactilares que resultan del ADN de diferentes personas siempre son diferentes (excepto quizás para hermanos idénticos), porque el número y el tamaño de los fragmentos están determinados por la secuencia única de bases en el ADN de cada persona.

La toma de huellas dactilares de ADN tiene muchas aplicaciones, pero la más conocida es probablemente su uso en investigaciones de delitos. En estos casos, la huella de ADN generalmente se crea a partir de una muestra de tejido, como sangre o folículos pilosos, recolectada en la escena del crimen. Se puede producir una huella dactilar a partir de tejido dejado en la escena años antes. Luego, esta huella digital se compara con las huellas de ADN de varios sospechosos. Una coincidencia revela, con un alto grado de certeza, la persona que fue la fuente de la muestra de la escena del crimen (Figura 21.A).

Por supuesto, el grado de certeza de una coincidencia entre las huellas dactilares de ADN depende de qué tan cuidadosamente se haya realizado el análisis. Debido a que las huellas dactilares de ADN se utilizan como prueba en un número creciente de casos judiciales cada año, es importante que se establezcan estándares nacionales para garantizar la confiabilidad de estos testigos moleculares. En general, es más fácil declarar con certeza que dos huellas dactilares de ADN no coinciden que estar seguro de que sí. En los Estados Unidos, más de 200 convictos han sido declarados inocentes a través de pruebas de ADN durante la última década.

¿Las pruebas de ADN han ido demasiado lejos? Todos los estados de los Estados Unidos recolectan muestras de ADN de personas condenadas por delitos sexuales y asesinato. Varios otros estados también recolectan muestras de ADN de personas condenadas por otros delitos graves, como robo. Aproximadamente 30 estados recolectan muestras de ADN de personas acusadas de delitos menores, como merodeo, hurto o vandalismo. En muchos casos, el ADN se almacena en una base de datos, incluso si la persona es inocente del delito. Las personas que simplemente cooperan con la investigación también pueden proporcionar muestras de ADN. Estos también se agregan a una base de datos nacional.

• ¿Cree que todas las personas arrestadas por un delito deberían tener derecho a la toma de huellas dactilares de ADN para demostrar su inocencia? Si es así, ¿quién debería pagar por el proceso?

• ¿La creación de una base de datos nacional de huellas dactilares de ADN es una invasión de la privacidad? ¿Es más que una base de datos de huellas digitales reales o fotografías policiales?

• ¿En qué condiciones cree que deberían obtenerse las muestras de ADN?

Destacando los conceptos

• El ADN consta de dos hebras de nucleótidos unidas por enlaces de hidrógeno y trenzadas para formar una doble hélice. Cada nucleótido consta de un fosfato, un azúcar llamado desoxirribosa y una de las cuatro bases nitrogenadas: adenina, timina, citosina o guanina. Los componentes de azúcar y fosfato de los nucleótidos se alternan a lo largo de los dos lados de la molécula. Los pares de bases se encuentran y forman enlaces de hidrógeno en el interior de la doble hélice, estos pares se asemejan a los peldaños de una escalera.

• De acuerdo con las reglas del apareamiento de bases complementarias, la adenina se une solo a la timina y la citosina solo se une a la guanina.

Replicación del ADN (págs. 435-436)

• La replicación del ADN es semiconservativa. Cada nueva molécula de ADN de doble hebra consta de una hebra antigua y una nueva. La enzima ADN polimerasa "descomprime" las dos hebras de una molécula (la molécula madre), permitiendo que cada hebra sirva como plantilla para la formación de una nueva hebra. El emparejamiento de bases complementario garantiza la precisión de la replicación.

Expresión genética (págs. 436-441)

• La información genética se transcribe del ADN al ARN y luego se traduce en una proteína.

• La transcripción es la síntesis de ARN mediante el apareamiento de bases en una plantilla de ADN. El ARN se diferencia del ADN en que el azúcar ribosa reemplaza a la desoxirribosa y la base uracilo reemplaza a la timina. La mayor parte del ARN es monocatenario.

• El ARN mensajero (ARNm) lleva el mensaje genético del ADN al citoplasma, donde se traduce en proteína. El código genético se lee en secuencias de tres nucleótidos de ARN, cada triplete se denomina codón. Cada uno de los 64 codones especifica un aminoácido particular o indica el punto donde la traducción debe comenzar o detenerse.

• El ARN de transferencia (ARNt) interpreta el código genético. En un extremo de la molécula de ARNt hay una secuencia de tres nucleótidos llamada anticodón que se empareja con un codón en el ARNm de acuerdo con las reglas de emparejamiento de bases. La cola del tRNA se une a un aminoácido específico.

• Cada una de las dos subunidades de un ribosoma consta de ARN ribosómico (ARNr) y proteína. Un ribosoma une el ARNt y el ARNm para la síntesis de proteínas.

• La traducción del código genético en proteína comienza cuando las dos subunidades ribosómicas y un ARNm se ensamblan, con el ARNm ubicado en un surco entre las dos subunidades del ribosoma. El ARNm se une al ribosoma en el codón de inicio del ARNm. Luego, el ribosoma se desliza a lo largo de la molécula de ARNm, leyendo un codón a la vez. Las moléculas de ARNt transportan aminoácidos al ARNm y los agregan a una cadena de proteínas en crecimiento. La traducción se detiene cuando se encuentra un codón de parada. Luego, la cadena de proteínas se separa del ribosoma.

• Una mutación puntual es un cambio en uno o unos pocos nucleótidos en la secuencia de una molécula de ADN. Cuando un nucleótido se sustituye por error por otro, la función de la proteína resultante puede afectar o no a la función de la proteína. La inserción o eliminación de un nucleótido siempre cambia la proteína resultante.

Regulación de la actividad genética (p. 442)

• La actividad genética está regulada a varios niveles. Por lo general, la mayor parte del ADN está plegado y enrollado. Para que un gen esté activo, la región del ADN en la que se encuentra debe estar desenrollada. La actividad genética puede verse afectada por otros segmentos de ADN. Las regiones de ADN llamadas potenciadores pueden aumentar la cantidad de ARN producido. Las señales químicas como las proteínas reguladoras u hormonas también pueden afectar la actividad genética.

Ingeniería genética (págs. 442-450)

• La ingeniería genética es la manipulación intencionada de material genético por humanos. Puede usarse para producir grandes cantidades de un producto genético particular o para transferir un rasgo genético deseable de una especie a otra oa otro miembro de la misma especie.

• La ingeniería genética usa enzimas de restricción para cortar el ADN de origen, que contiene el gen de interés, y el ADN del vector en lugares específicos, creando extremos pegajosos compuestos de bases complementarias no apareadas que permiten que los segmentos cortados se recombinen. El vector recombinante se usa luego para transferir el ADN recombinante a una célula huésped. Los vectores comunes incluyen plásmidos bacterianos y virus. La célula huésped es a menudo un tipo de célula que se reproduce rápidamente, como una bacteria o una célula de levadura. Cada vez que una célula huésped se divide, ambas células hijas reciben una copia del gen de interés. La introducción de un gen de una especie en una especie diferente da como resultado una planta o animal transgénico.

• La ingeniería genética ha tenido muchas aplicaciones en la agricultura animal y vegetal, la ciencia ambiental y la medicina.

• En la terapia génica, se introduce una forma sana de un gen en las células del cuerpo para corregir los problemas causados ​​por un gen defectuoso.

• Un genoma consta de todos los genes de un solo organismo.

La genómica es el estudio de los genomas y la interacción entre los genes y el medio ambiente. Ahora se cree que el genoma humano consta de 20.000 a 25.000 genes.

• Los científicos usan microarrays para analizar la actividad genética en diferentes condiciones. Utiliza chips de ADN, portaobjetos de vidrio con miles de segmentos de ADN estampados en ellos. La información puede ser útil para tratar enfermedades genéticas. El análisis de microarrays también permite a los científicos descubrir pequeñas diferencias en las secuencias de genes de las personas. Los científicos esperan utilizar esta información para desarrollar tratamientos individualizados.

• Grandes porciones de nuestro ADN son iguales al ADN de otros organismos. Cuanto más cercana sea la relación evolutiva, mayor porción de ADN tenemos en común.

1. Describe la estructura del ADN. pag. 434

2. Explique por qué el apareamiento de bases complementarias es crucial para la replicación exacta del ADN. pag. 435

3. ¿Por qué la replicación del ADN se describe como semiconservativa? pag. 436

4. Explica las funciones de la transcripción y la traducción en la conversión del mensaje de ADN en una proteína. págs. 436-437

5. ¿En qué se diferencia el ARN del ADN? págs. 436-437

6. ¿Qué funciones desempeñan el ARNm, el ARNt y el ARNr en la síntesis de proteínas? pag. 437

7. Defina el codón. ¿Qué papel juegan los codones en la síntesis de proteínas? pag. 438

8. ¿Cuál es el papel de un anticodón? págs. 438-439

9. Describa los eventos que ocurren durante el inicio de la síntesis de proteínas, el alargamiento de la cadena de proteínas y la terminación de la síntesis. págs. 439-441

10. ¿Por qué una eliminación tiene un efecto tan importante en una célula? págs. 441-442

11. ¿Cómo se regula la actividad genética? pag. 442

12. Defina la ingeniería genética. Explicar las funciones de las enzimas de restricción y los vectores en la ingeniería genética. págs. 442-445

13. Describa algunas de las formas en que se ha utilizado la ingeniería genética en la agricultura y la medicina. págs. 445-450

14. ¿Qué es la terapia génica? págs. 448-450

15. La base complementaria de la timina es

16. Aunque la cantidad de cualquier base particular en el ADN variará entre los individuos, la cantidad de guanina siempre será igual a la cantidad de

B. ARNm complementario a una hebra molde de ADN.

C. ARNt complementario al ARNm.

19. El anticodón se encuentra en una molécula de _____.

20. En el ARN, el nucleótido _____ se une a la adenina.

21. En la ingeniería genética, los cortes escalonados en el ADN que permiten que los genes se empalmen juntos los realiza ____.

Utilice el código genético de la figura 21.5 (p. 438) para responder las preguntas 1 y 2.

1. ¿Cuál sería la secuencia de aminoácidos en el polipéptido resultante de una hebra de ARNm con la siguiente secuencia de bases?

2. Las siguientes son secuencias de bases en cuatro cadenas de ARNm: una normal y tres con mutaciones. (Tenga en cuenta que la traducción comienza con un codón de inicio y termina con un codón de terminación). ¿Cuál de las secuencias mutadas es probable que tenga los efectos más graves? ¿Por qué? ¿Cuál tendría los efectos menos severos? ¿Por qué?

ARNm normal: AUG ACA UAU GAG ACG ACU

Mutación 1: AUG ACC UAC GAA ACG ACC

Mutación 2: AUG ACU UAA GAG ACG ACA

Mutación 3: AUG ACG UAU GAG ACG ACG

3. Es un investigador de la escena del crimen que testifica en un juicio por asesinato. Las huellas de ADN que se muestran a la derecha son las de una mancha de sangre en la escena del crimen (no la sangre de la víctima) y las de siete sospechosos (numerados del 1 al 7). ¿La sangre de qué sospechoso coincide con la mancha de sangre de la escena del crimen?

Alfabetización en información

Describa algunos de los posibles usos médicos de la información obtenida del Proyecto Genoma Humano. ¿Qué cuestiones éticas plantea el proyecto? Utilice al menos tres fuentes confiables (revistas, libros, sitios web) para responder estas preguntas. Explique por qué eligió esas fuentes.

1 Desarrollaremos este concepto a medida que avance el capítulo. Algunos genes codifican un polipéptido que es solo una parte de una proteína funcional. Un gen también puede codificar el ARN que forma parte de un ribosoma o que transporta aminoácidos durante la síntesis de proteínas.

2 Los plásmidos parecen haber evolucionado como un medio para mover genes entre bacterias. Un plásmido puede replicarse y pasar, con sus genes, a otra bacteria.

Si usted es el propietario de los derechos de autor de cualquier material contenido en nuestro sitio y tiene la intención de eliminarlo, comuníquese con el administrador de nuestro sitio para su aprobación.


GENMARK: reconocimiento de genes en paralelo para ambas cadenas de ADN ☆

El problema de predecir la ubicación de los genes en el ADN recién secuenciado es bien conocido, pero aún está lejos de resolverse con éxito. Anteriormente se sugirió un enfoque novedoso del problema basado en los modelos de cadena de Markov dependientes del marco (no homogéneos) de las regiones codificantes de proteínas. Este enfoque es, aparentemente, uno de los métodos de "búsqueda por contenido" más poderosos. La idea inicial del método combina los modelos específicos de Markov de región codificante y no codificante junto con la función de toma de decisiones de Bayes & # x27 y permite una fácil generalización para el empleo de modelos de cadena de Markov de orden superior. Otra generalización que se describe en este artículo permite el análisis de ambas cadenas de ADN simultáneamente. Los métodos de búsqueda de genes actualmente conocidos realizan el análisis de las dos cadenas de ADN sucesivamente, una tras otra. Al hacer esto, todos los métodos conocidos fallan en el sentido de que generan señales de predicción falsas (artefactos) para la hebra dada cuando la región de codificación real está ubicada en la hebra de ADN complementaria. Este inconveniente común se evita empleando el algoritmo bayesiano que usa un modelo de cadena de Markov no homogéneo adicional de la "sombra" de la región codificante, la secuencia que es complementaria a la secuencia codificante de la proteína.

La versión preliminar de este trabajo fue presentada durante el Segundo Taller Internacional de Problemas Abiertos en Biología Molecular Computacional, Centro de Investigación de Verano de Telluride, Telluride, Colorado, 19 de julio a 2 de agosto de 1992.


Samacheer Kalvi 12th Bio Zoology Molecular Genetics Text Book Volver Preguntas y respuestas

Pregunta 1.
El experimento de Hershey y Chase con bacteriófagos mostró que
(a) La proteína ingresa a las células bacterianas
(b) el ADN es el material genético
(c) el ADN contiene azufre radiactivo
(d) Los virus se transforman
Respuesta:
(b) el ADN es el material genético

Pregunta 2.
El ADN y el ARN son similares con respecto a
(a) Timina como base de nitrógeno
(b) Una forma de hélice monocatenaria
(c) Nucleótidos que contienen azúcares, bases nitrogenadas y fosfatos.
(d) La misma secuencia de nucleótidos para el aminoácido fenilalanina.
Respuesta:
(c) Nucleótidos que contienen azúcares, bases nitrogenadas y fosfatos.

Pregunta 3.
Una molécula de ARNm es producida por
(a) Replicación
(b) Transcripción
(c) Duplicación
(d) Traducción
Respuesta:
(b) Transcripción

Pregunta 4.
Se estima que el número total de bases nitrogenadas en el genoma humano es de aproximadamente
(a) 3,5 millones
(b) 35000
(c) 35 millones
(d) 3,1 mil millones
Respuesta:
(d) 3,1 mil millones

Pregunta 5.
Las células de E. coli cultivadas en medio 15N se transfieren a medio 14N y se dejan crecer durante dos generaciones. El ADN extraído de estas células se ultracentrifuga en un gradiente de densidad de cloruro de cesio. ¿Qué distribución de densidad de ADN esperarías en este experimento?
(a) Una banda de alta y una de baja densidad
(b) Una banda de densidad intermedia
(c) Una banda de densidad alta y otra intermedia
(d) Una banda de densidad baja y otra intermedia
Respuesta:
(d) Una banda de densidad baja y otra intermedia

Pregunta 6.
¿Cuál es la base de la diferencia en la síntesis de la cadena principal y rezagada de moléculas de ADN?
(a) El origen de la replicación ocurre solo en el extremo 5 'de las moléculas
(b) La ADN ligasa funciona solo en la dirección 3 '→ 5'
(c) La ADN polimerasa puede unir nuevos nucleótidos solo al extremo 3 'del rodal en crecimiento.
(d) Helicasas y proteínas de unión de una sola hebra que funcionan en el extremo 5 '
Respuesta:
(d) Helicasas y proteínas de unión de una sola hebra que funcionan en el extremo 5 '

Pregunta 7.
¿Cuál de las siguientes es la secuencia correcta de eventos con referencia al dogma central?
(a) Transcripción, traducción, replicación
(b) Transcripción, replicación, traducción
(c) Duplicación, traducción, transcripción
(d) Replicación, transcripción, traducción
Respuesta:
(d) Replicación, transcripción, traducción

Pregunta 8.
¿Cuál de las siguientes afirmaciones sobre la replicación del ADN no es correcta?
(a) El desenrollamiento de la molécula de ADN ocurre cuando se rompen los enlaces de hidrógeno.
(b) La replicación ocurre cuando cada base se empareja con otra exactamente igual
(c) El proceso se conoce como replicación semi & # 8211 conservadora porque una hebra antigua se conserva en la nueva molécula
(d) Los pares de bases complementarios se mantienen unidos con enlaces de hidrógeno.
Respuesta:
(b) La replicación ocurre cuando cada base se empareja con otra exactamente igual

Pregunta 9.
¿Cuál de las siguientes afirmaciones no es cierta sobre la replicación del ADN en eucariotas?
(a)) La replicación comienza en un solo origen de replicación.
(b) La replicación es bidireccional desde los orígenes.
(c) La replicación se produce a aproximadamente 1 millón de pares de bases por minuto.
(d) Existen numerosos cromosomas bacterianos diferentes, y la replicación ocurre en cada uno al mismo tiempo.
Respuesta:
(d) Existen numerosos cromosomas bacterianos diferentes, y la replicación ocurre en cada uno al mismo tiempo.

Pregunta 10.
El primer codón que se descifró fue qué códigos para
(a) AAA, prolina
(b) GGG, alanina
(c) UUU, fenilalanina
(d) TTT, arginina
Respuesta:
(c) UUU, fenilalanina

Pregunta 11.
El experimento de Meselson y Stahl demostró __________
(a) Transducción
(b) Transformación
(c) el ADN es el material genético
(d) Naturaleza semiconservadora de la replicación del ADN
Respuesta:
(d) Naturaleza semiconservadora de la replicación del ADN

Pregunta 12.
Los ribosomas se componen de dos subunidades, la subunidad más pequeña de un ribosoma tiene un sitio de unión y la subunidad más grande tiene dos sitios de unión para dos
Respuesta:
ARNm, ARNt

Pregunta 13.
Anoperonisa:
(a) Proteína que suprime la expresión génica
(b) Proteína que acelera la expresión génica
(c) Grupo de genes estructurales con función relacionada
(d) Gen que activó o desactivó otros genes
Respuesta:
(d) Gen que activó o desactivó otros genes

Pregunta 14.
Cuando la lactosa está presente en el medio de cultivo:
(a) Se produce la transcripción de los genes lacy, lac z, lac a
(b) El represor no puede unirse al operador
(c) El represor puede unirse al operador
(d) Ambos (a) y (b) son correctos
Respuesta:
(d) Ambos (a) y (b) son correctos

Pregunta 15.
Da razones: el código genético es "universal".
Respuesta:
El código genético es universal. Significa que todos los sistemas vivos conocidos utilizan ácidos nucleicos y los mismos codones de tres bases (codón triplete) dirigen la síntesis de proteínas a partir de aminoácidos. Por ejemplo, el codón del ARNm (UUU) codifica la fenilalanina en todas las células de todos los organismos. Se informan algunas excepciones en genomas procarióticos, mitocondriales y de cloroplasto. Sin embargo, las similitudes son más comunes que las diferencias.

Pregunta 16.
Nombra las partes marcadas con "A" y "B" en la unidad de transcripción dada:
Respuesta:

Pregunta 17.
Diferenciar & # 8211 Hebra principal y hebra rezagada
Respuesta:

  1. ADN polimerasa I Mecanismo de reparación del ADN involucrado
  2. ADN polimerasa II Mecanismo de reparación del ADN involucrado
  3. ADN polimerasa III involucrada en la replicación del ADN

Pregunta 18.
Diferenciar & # 8211 hebra de plantilla y hebra de codificación.
Respuesta:

  1. Cadena de plantilla: durante la replicación, la cadena de ADN que tiene la polaridad 3 '→ 5' actúa como cadena de plantilla.
  2. Cadena de codificación: durante la replicación, la cadena de ADN que tiene la polaridad 5 '→ 3' actúa como cadena de codificación.

Pregunta 19.
Mencione dos formas en las que el polimorfismo de un solo nucleótido (SNP) identificado en el genoma humano puede traer un cambio revolucionario en la ciencia biológica y médica.
Respuesta:
Los científicos han identificado alrededor de 1,4 millones de ubicaciones, donde las diferencias de ADN de una sola base (SNP & # 8211 Polimorfismo de nucleótido único & # 8211 pronunciado como "snips") ocurren en humanos. La identificación de "SNIPS" es útil para encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 20.
Indique los tres objetivos del proyecto del genoma humano.
Respuesta:

  1. Identifique todos los genes (aproximadamente 30000) en el ADN humano.
  2. Determine la secuencia de los tres mil millones de pares de bases químicas que componen el ADN humano.
  3. Almacenar esta información en bases de datos.

Pregunta 21.
En E. coli, se producen tres enzimas O-galactosidasa, permeasa y transacetilasa en presencia de lactosa. Explique por qué las enzimas no se sintetizan en ausencia de lactosa.
Respuesta:
En ausencia de lactosa, la proteína represora se une al operador e impide la transcripción del gen estructural por la ARN polimerasa, por lo que no se producen las enzimas. Sin embargo, siempre habrá un nivel mínimo de expresión del operón lac incluso en ausencia de lactosa.

Pregunta 22.
Distinguir entre gen estructural, gen regulador y gen operador.
Respuesta:
Estructura del operón: cada operón es una unidad de expresión y regulación génica y consta de uno o más genes estructurales y un gen operador adyacente que controla la actividad transcripcional del gen estructural.

  1. El gen estructural codifica proteínas, rRNA y tRNA requeridos por la célula.
  2. Los promotores son las secuencias señal en el ADN que inician la síntesis de ARN. La ARN polimerasa se une al promotor antes del inicio de la transcripción.
  3. Los operadores están presentes entre los promotores y los genes estructurales. La proteína represora se une a la región operadora del operón.

Pregunta 23.
Un bajo nivel de expresión del operón lac ocurre todo el tiempo en E-coli. Justifica la afirmación.
Respuesta:
Una de las enzimas sintetizadas por el operón lac es la permeasa, que participa en el transporte de lactosa al interior de las células. Si el operón lac se inactiva, la permeasa no se sintetiza, por lo que la lactosa no puede ingresar a la célula. La lactosa actúa como inductor, se une a la proteína represora y activa al operador para iniciar la expresión génica.

Pregunta 24.
¿Por qué el proyecto del genoma humano se llama megaproyecto?
Respuesta:
El proyecto internacional del genoma humano se lanzó en el año 1990. Fue un megaproyecto y tardó 13 años en completarse. El genoma humano es aproximadamente 25 veces más grande que el genoma de cualquier organismo secuenciado hasta la fecha y es el primer genoma de vertebrado en completarse. Se dice que el genoma humano tiene aproximadamente 3 & gt109 pb. HGP estuvo estrechamente asociado con el rápido desarrollo de una nueva área en biología llamada bioinformática.

Pregunta 25.
A partir de su examen de la estructura del ADN, ¿qué dedujeron Watson y Crick sobre el probable mecanismo de replicación, capacidad de codificación y mutación del ADN?
Respuesta:
Inferencia de Watson y Crick sobre la replicación del ADN: Llegaron a la conclusión de que cada una de las cadenas de ADN en una hélice actúa como plantilla durante la replicación del ADN, lo que lleva a la formación de nuevas moléculas de ADN hijas, que son complementarias a la cadena parental (es decir, método semiconservador de replicación) Inferencia sobre la capacidad de codificación: Durante la transcripción, la información genética en la cadena de ADN se codifica en ARNm como bases complementarias (excepto para uracilo en lugar de timina en el ARN) Inferencia sobre mutación: Cualquier cambio en la secuencia de nucleótidos del ADN conduce a alteración correspondiente en la secuencia de aminoácidos de una proteína específica, lo que confirma la validez del código genético.

Pregunta 26.
¿Por qué el ARNt se llama molécula adaptadora?
Respuesta:
La molécula de ARN de transferencia (ARNt) de una célula actúa como un vehículo que recoge los aminoácidos esparcidos por el citoplasma y también lee códigos específicos de moléculas de ARNm. Por eso se le llama molécula adaptadora. Este término fue postulado por Francis Crick.

Pregunta 27.
¿Cuáles son las tres diferencias estructurales entre el ARN y el ADN?
Respuesta:
ADN:

  1. El azúcar es azúcar desoxirribosa.
  2. Estructura bicatenaria.
  3. Las bases nitrogenadas son adenina, guanina, citosina y timina.
  1. El azúcar es azúcar ribosa.
  2. Molécula monocatenaria.
  3. Las bases nitrogenadas son adenina, guanina, citosina y uracilo.

Pregunta 28.
Nombre el anticodón necesario para reconocer los siguientes codones:
AAU, CGA, UAU y GCA.
Respuesta:
UUA, GCU, AUA y CGU.

Pregunta 29.
(a) Identifique la figura que se da a continuación
(b) Vuelva a dibujar la estructura como una bifurcación de replicación y etiquete las partes
(c) Escriba la fuente de energía para esta replicación y nombre la enzima involucrada en este proceso.
(d) Mencione las diferencias en la síntesis de proteínas, basadas en la polaridad de las dos cadenas molde.
Respuesta:
(a) Bifurcación de replicación
(B)

(c) Deoxi nucleótido, el trifosfato actúa como fuente de energía para la replicación. La ADN polimerasa se utiliza para la replicación.
(d) La información de contacto del ARNm para la síntesis de proteínas se desarrollará a partir de una cadena de ADN con polaridad 5 '→ 3'

Pregunta 30.
Si la secuencia de codificación en una unidad de transcripción se escribe de la siguiente manera:
5 ’TGCATGCATGCATGCATGCATGCATGC 3’
Anote la secuencia de ARNm.
Respuesta:
La secuencia de ARNm es 3’ACGUACGUACGUUCGUACGUACGUACG5 ’

Pregunta 31.
¿Cómo es ventajoso el proceso de síntesis de proteínas en dos etapas?
Respuesta:
La característica del gen dividido de los genes eucariotas está casi completamente ausente en los procariotas. Originalmente, cada exón puede haber codificado una única cadena polipeptídica con una función específica. Dado que la disposición de los exones y la eliminación de los intrones son flexibles, el exón que codifica estas subunidades polipeptídicas actúa como dominios que se combinan de diversas formas para formar nuevos genes. Los genes individuales pueden producir diferentes proteínas funcionales ordenando sus exones de varias formas diferentes a través de patrones de empalme alternativos, un mecanismo que se sabe que juega un papel importante en la generación de diversidad funcional y de proteínas en los animales. Los intrones habrían surgido antes o después de la evolución del gen eucariota.

Si los intrones surgieron tarde, ¿cómo entraron en el gen eucariota? Los intrones son secuencias de ADN móviles que pueden empalmarse de, así como en, "sitios objetivo" específicos que actúan como elementos móviles similares a transposones (que median la transferencia de genes entre organismos & # 8211 Horizontal Gene Transfer & # 8211 HGT). La HGT ocurre entre linajes de células procariotas, o de células procariotas a eucariotas y entre células eucariotas. Ahora se plantea la hipótesis de que la HGT jugó un papel importante en la evolución de la vida en la Tierra.

Pregunta 32.
¿Por qué Hershey y Chase utilizaron únicamente fósforo y azufre marcados radiactivamente? ¿Habrían obtenido el mismo resultado si usaran carbono y nitrógeno radiomarcados?
Respuesta:
Generalmente las proteínas contienen azufre pero no fósforo y el ácido nucleico (ADN) contiene fósforo pero no azufre. Por lo tanto, Hershey & # 8211 Chase utilizó isótopos radiactivos de azufre (3 5 S) y fósforo (32 P) para realizar un seguimiento separado de la proteína viral y el ácido nucleico en el medio de cultivo. No se puede lograr el resultado esperado si se usa carbono y nitrógeno radiactivos, ya que estas moléculas están presentes tanto en el ADN como en las proteínas.

Pregunta 33.
Explica la formación de un nucleosoma.
Respuesta:
Komberg propuso un modelo para el nucleosoma, en el que 2 moléculas de las cuatro proteínas histonas H2A, H2B, H3 y H4 se organizan para formar una unidad de ocho moléculas llamada histona octamere.

El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN. Los octameros de histonas están en estrecho contacto y el ADN está enrollado en el exterior del nucleosoma.

Pregunta 34.
Está establecido que el ARN es el primer material genético. Justifica dando razones.
Respuesta:
Tres biólogos moleculares a principios de la década de 1980 (Leslie Orgel, Francis Brick y Carl Woese) propusieron de forma independiente el "mundo del ARN" como la primera etapa en la evolución de la vida, una etapa en la que el ARN catalizaba todas las moléculas necesarias para la supervivencia y la replicación. El término "mundo de ARN", utilizado por primera vez por Walter Gilbert en 1986, plantea la hipótesis de que el ARN es la primera genética de la Tierra. Ahora hay suficiente evidencia para sugerir que los procesos vitales esenciales (como el metabolismo, la traducción y el empalme, etc.) evolucionaron alrededor del ARN. El ARN tiene la capacidad de actuar como material genético y catalizador. Hay varias reacciones bioquímicas en los sistemas vivos que son catalizadas por ARN. Este ARN catalítico se conoce como ribozima. Pero, el ARN como catalizador era reactivo y, por lo tanto, inestable.

Esto condujo a la evolución de una forma de ADN más estable, con ciertas modificaciones químicas. Dado que el ADN es una molécula de doble hebra que tiene una hebra complementaria, ha resistido los cambios al desarrollar un proceso de reparación. Algunas moléculas de ARN funcionan como reguladores de genes al unirse al ADN y afectar la expresión de genes. Algunos virus usan ARN como material genético. Andrew Fire y Craig Mellow (ganadores del Premio Nobel en 2006) opinaron que el ARN es un ingrediente activo en la química de la vida.

Samacheer Kalvi 12th Bio Zoology Molecular Genetics Preguntas y respuestas adicionales

Pregunta 1.
El término "gen" fue acuñado por ___________
Respuesta:
Wilhelm Johannsen

Pregunta 2.
¿El experimento de quién finalmente proporcionó evidencia convincente de que el ADN es el material genético?
(a) Experimento de Griffith
(b) El experimento de Avery, Macleod y McCarty
(c) Experimento de Hershey-Chase
(d) Experimento de Urey-Miller
Respuesta:
(c) Experimento de Hershey-Chase

Pregunta 3.
En el experimento de Hershey & # 8211 Chase, el ADN de la fase T 2 se hizo radioactivo usando ___________
(a) 32 P
(b) 32 S
(c) 35 P
(d) 32 S
Respuesta:
(a) 32 P

Pregunta 4.
Un nucleósido se compone de ___________
(a) Azúcar y fosfato
(b) Base de nitrógeno y fosfato
(c) Base de azúcar y nitrógeno
(d) Azúcar, fosfato y base nitrogenada
Respuesta:
(c) Base de azúcar y nitrógeno

Pregunta 5.
Identificar la declaración incorrecta
(a) una base es una sustancia que acepta iones H +
(b) Tanto el ADN como el ARN tienen cuatro bases
(c) Las purinas tienen un solo anillo carbono-nitrógeno
(d) La timina es única para el ADN
Respuesta:
(c) Las purinas tienen un solo anillo carbono-nitrógeno

Pregunta 6.
Watson y Crick propusieron su modelo de ADN de doble hélice basado en el análisis de difracción de rayos X de ___________
a) Erwin Chargaff
(b) Meselson y Stahl
(c) Wilkins y Franklin
(d) Griffith
Respuesta:
(c) Wilkins y Franklin

Pregunta 7.
El término "mundo de ARN" fue utilizado por primera vez por ___________
Respuesta:
Walter Gilbert

Pregunta 8.
La distancia entre dos pares de bases consecutivos en el ADN es ___________
(a) 0,34 nm
(b) 3,4 nm
(c) 0,034 nm
(d) 34 millas náuticas
Respuesta:
(a) 0,34 nm

Pregunta 9.
Si la longitud del ADN de E. coli es 1,36 mm, el número de pares de bases es ___________
(a) 0,36 × 10 6 m
(b) 4 × 10 6 m
(c) 0,34 × 10 -9 nm
(d) 4 × 10 -9 m
Respuesta:
(b) 4 × 10 6 m

Pregunta 10.
Identificar la secuencia adecuada en la organización del cromosoma eucariota.
(a) Nucleosoma & # 8211 Solenoide & # 8211 Cromátida
(b) Cromátida y nucleosoma # 8211 y solenoide # 8211
(c) Solenoide y cromatina # 8211 y ADN # 8211
(d) Nucleosoma & # 8211 solenoide & # 8211 genophore
Respuesta:
(a) Nucleosoma & # 8211 Solenoide & # 8211 Cromátida

Pregunta 11.
Afirmación (A): el genóforo se nota en los procariotas.
Razón (R): Las bacterias poseen ADN circular sin organización de cromatina.
(a) Tanto A como R son correctos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(c) R explica A

Pregunta 12.
Afirmación (A): La heterocromatina es transcripcionalmente activa.
Razón (R): cromatina compacta que se tiñe de oscuro.
(a) Tanto A como R son correctos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(d) A es incorrecto R es correcto

Pregunta 13.
Afirmación (A): Hershey y Chase propusieron un modelo semiconservador.
Razón (R): el ADN hijo contiene solo hebras nuevas.
(a) Tanto A como R son incorrectos
(b) A es correcto R es incorrecto
(c) R explica A
(d) A es incorrecto R es correcto
Respuesta:
(a) Tanto A como R son incorrectos

Pregunta 14.
La enzima de Komberg se llama _____
Respuesta:
ADN polimerasa I

Pregunta 15.
La replicación del ADN ocurre en la fase __________ del ciclo celular.
(soy
(b) S
(c) G1
(d) G2
Respuesta:
(b) S

Pregunta 16.
El modelo semiconservador de replicación fue probado por __________
(a) Hershey y Chase
(b) Griffith
(c) Meselson y Stahl
(d) Macleod y McCarty
Respuesta:
(c) Meselson y Stahl

Pregunta 17.
¿Cuántos tipos de ADN polimerasas posee una célula eucariota?
(un dos
(b) tres
(c) cuatro
(d) cinco
Respuesta:
(d) Cinco

Pregunta 18.
Identificar la declaración incorrecta
(a) La replicación ocurre en el sitio ori & # 8211 del ADN
(b) El desoxi nucleótido trifosfato actúa como sustrato
(c) El desenrollamiento de la cadena de ADN se lleva a cabo mediante topoisomerasa.
(d) La ADN polimerasa cataliza la polimerización en 3-OH
Respuesta:
(c) El desenrollamiento de la cadena de ADN se lleva a cabo mediante topoisomerasa.

Pregunta 19.
Los fragmentos de hebra rezagada sintetizados de forma discontinua se denominan ________
Respuesta:
Fragmentos de Okazaki

Pregunta 20.
Los retrovirus poseen ________ como material genético.
Respuesta:
ARN

Pregunta 21.
¿Cuál NO forma parte de la unidad de transcripción?
(a) Promotor
(b) Operador
(c) Gen estructural
(d) Terminador
Respuesta:
(b) Operador

Pregunta 22.
Goldberg & # 8211 Hogness caja de eucariotas es equivalente a ________ de procariotas.
Respuesta:
Caja Pribnow

Pregunta 23.
Los fragmentos de Okazaki son unidos por la enzima ________ durante la replicación del ADN.
Respuesta:
ADN ligasa

Pregunta 24.

Respuesta:
(a) A & # 8211 iv, B & # 8211 i, C & # 8211 ii, D & # 8211 iii

Pregunta 25.
La ARN polimerasa de los procariotas se une al factor para iniciar la polimerización.
(a) rho
(b) theta
(c) sigma
(d) psi
Respuesta:
(c) sigma

Pregunta 26.

(a) Tapado
(b) Colas
(c) Empalme
(d) Transcripción
Respuesta:
(c) Empalme

Pregunta 27.
¿Cuál de las siguientes características está ausente en los procariotas?
(a) Los procariotas poseen tres tipos principales de ARN
(b) Los genes estructurales son policistrónicos
(c) El proceso de inicio de la transcripción requiere el factor "P"
(d) Característica del gen dividido
Respuesta:
(d) Característica del gen dividido

Pregunta 28.
¿Cuál de las siguientes secuencias se ha traducido por completo?
(i) AGA, UUU, UGU, AGU, UAG
(ii) AUG, UUU, AGA, UAC, UAA
(iii) AAA, UUU, UUG, UGU, UGA
(iv) AUG, AAU, AAC, UAU, UAG
(a) iy ii
(b) ii solamente
(c) i y iii
(d) ii y iv
Respuesta:
(d) ii y iv

Pregunta 29.
El taponamiento del ARNm se produce mediante __________
(a) Residuos de poli A
(b) Trifosfato de metilguanosina
(c) Trifosfato de desoxi ribonucleótido
(d) Ribonucleótido trifosfato
Respuesta:
(b) Trifosfato de metil guanosina

Pregunta 30.
¿Uno de los aspectos no es una característica del código genético?
(especifico
(b) Degenerado
(c) Universal
(d) ambiguo
Respuesta:
(d) ambiguo

Pregunta 31.
¿Cuál de los codones del triplete no es un código de prolina?
(i) CCU
(ii) CAU
(iii) CCG
(iv) CAA
(a) yo solo
(b) ii y iv
(c) iii solamente
(d) todo lo anterior
Respuesta:
(b) ii y iv

Pregunta 32.
Las secuencias codificantes que se encuentran en genes divididos se denominan.
(a) Operones
(b) Intrones
(c) Exones
(d) Cistron
Respuesta:
(c) Exones

Pregunta 33.
¿Cuál de los siguientes ARNm produce 6 aminoácidos después de la traducción?
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU
(ii) UGA AGA UAG GAG CAU CCC UAC UAU GAU
(iii) GUC UGC UGG GCU GAU UAA AGG AGC AUU
(iv) AGO UAC CAU UGC UGA UGC AGG AGC CCG
Respuesta:
(i) UCU UAU AGU CGA UGC AGU UGA AAA UUU

Pregunta 34.
El factor de terminación de la transcripción asociado con la ARN polimerasa en procariotas es
(a) θ
(b) σ
(c) ρ
(d) ∑
Respuesta:
(c) ρ

Pregunta 35.
En una doble hebra de ADN, si la guanina es del 30%, ¿cuál será el porcentaje de timina?
(a) 100%
(b) 20%
(c) 10%
(d) 70%
Respuesta:
(b) 20%

Pregunta 36.
Identificar los pares de tripletes que codifican la tirosina.
(a) UUU, UUC
(b) UAU, UAU
(c) UGC, UGU
(d) CAU, CAC
Respuesta:
(b) UAU, UAU

Pregunta 37.

Respuesta:
A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

Pregunta 38.
El código AUG es para __________
(a) Arginina
(b) Tirosina
(c) Triptófano
(d) Metionina
Respuesta:
(d) Metionina

Pregunta 39.
La secuencia de bases en la cadena codificante de ADN es G A G T T A G C A G G C, entonces la secuencia de codones en la transcripción primaria es
(a) C U C A U A C G C C C G
(b) C U C A A U C G U C C G
(c) U C A G A U C U G C G C
(d) U U C A A U C G U G C G
Respuesta:
(b) C U C A A U C G U C C G

Pregunta 40.
La región promotora de eucariotas es __________
(a) TATAA
(b) AGOSTO
(c) UUUGA
(d) AAAAU
Respuesta:
(a) TATAA

Pregunta 41.
Une el siguiente:
(A) AUG y # 8211 (i) Tirosina
(B) UGA y # 8211 (ii) Glicina
(C) UUU y # 8211 (iii) Metionina
(D) GGG y # 8211 (iv) Fenilalanina
(a) A & # 8211 iii B & # 8211 i C & # 8211 iv D & # 8211 ii
(b) A & # 8211 iii B & # 8211 ii C & # 8211 i D & # 8211 iv
(c) A & # 8211 iv B & # 8211 i C & # 8211 iii D & # 8211 ii
(d) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii
Respuesta:
(d) A & # 8211 ii B & # 8211 i C & # 8211 iv D & # 8211 iii

Pregunta 42.
__________ número de codones, códigos de cistina.
Respuesta:
Dos

Pregunta 43.
En la anemia de células falciformes, se modifica el codón __________ del gen de la globina β & # 8211.
(a) Octavo
(b) Séptimo
(c) Sexta
(d) Noveno
Respuesta:
(c) Sexta

Pregunta 44.
Elija la declaración incorrecta.
(a) El ARNt actúa como una molécula adaptadora
(b) Los codones de parada no tienen ARNt
(c) La adición de aminoácidos conduce a la hidrólisis del ARNt.
(d) ARNt tiene cuatro bucles principales
Respuesta:
(c) La adición de aminoácidos conduce a la hidrólisis del ARNt.

Pregunta 45.
¿Cuál de los siguientes antibióticos inhibe la interacción entre el ARNt y el ARNm?
(a) Neomicina
(b) Estreptomicina
(c) tetraciclina
(d) Cloranfenicol
Respuesta:
(a) Neomicina

Pregunta 47.
El grupo de genes con función relacionada se llama _________
(a) Cistron
(b) Operón
(c) Mutón
(d) Reconocimiento
Respuesta:
(b) Operón

Pregunta 48.
La proteína represora del operón Lac se une a __________ del operón.
(a) Región promotora
(b) Región del operador
(c) región del terminador
(d) región inductora
Respuesta:
(b) Región del operador

Pregunta 49.
Códigos del gen Lac Z para __________
(a) Permease
(b) transacetilasa
(c) β-galactosidasa
(d) Aminoacil transferasa
Respuesta:
(c) β-galactosidasa

Pregunta 50.
El modelo del operón lac fue propuesto por __________
Respuesta:
Jacob y Monod

Pregunta 51.
El recuento aproximado de pares de bases en el genoma humano es __________
Respuesta:
3 × 10 9 pb

Pregunta 52.
Las secuencias de ADN automatizadas son desarrolladas por.
Respuesta:
Frederick Sanger

Pregunta 53.
¿Cuál de los cromosomas tiene mayor densidad genética?
(a) Cromosoma 20
(b) Cromosoma 19
(c) Cromosoma 13
(d) Cromosoma Y
Respuesta:
(b) Cromosoma 19

Pregunta 54.
La cantidad de genes ubicados en el cromosoma Y es __________
(a) 2968
(b) 213
(c) 2869
(d) 231
Respuesta:
(d) 231

Pregunta 55.
¿Cuántos genes estructurales se encuentran en el operón lac de E. Coli?
(a) 4
(b) 3
(c) 2
(d) 1
Respuesta:
(b) 3

Pregunta 56.
La técnica de impresión digital de ADN fue desarrollada por
(a) Jacob y Monod
(b) Alec Jeffreys
(c) Frederick Sanger
Respuesta:
(b) Alec Jeffreys

Pregunta 57.
En la toma de huellas dactilares de ADN, la separación de los fragmentos de ADN se realiza mediante __________
(a) Centrifugación
(b) Electroforesis
(c) difracción de rayos X
(d) desnaturalización
Respuesta:
(b) Electroforesis

Pregunta 58.
SNP significa
(a) Polimorfismo de un solo nucleótido
(b) Polipéptido de un solo nucleósido
(c) Polimorfismo de un solo nucleótido
(d) Polímero de un solo nucleótido
Respuesta:
(a) Polimorfismo de un solo nucleótido

Pregunta 59.
Las secuencias específicas de ARNm que no se traducen son __________
Respuesta:
Regiones sin traducir (UTR)

Pregunta 60.
La secuencia de ADN no codificante o intermedia se llama __________

Pregunta 61.
_______ Intron es el monómero del ADN.
Respuesta:
Nucleótido

Pregunta 62.
¿Cuál de las siguientes coincidencias no coincide?
(a) Transcripción & # 8211 Copia de información de ADN a ARN
(b) Traducción & # 8211 Decodificación de información de ARNm a proteína
(c) Replicación y # 8211 Realización de copias de ADN
(d) Empalme y # 8211 Unión de exones con intrones
Respuesta:
(d) Empalme y # 8211 Unión de exones con intrones

Pregunta 1.
¿Quién propuso la hipótesis de Un gen & # 8211 Una enzima? Defínalo.
Respuesta:
George Beadle y Edward Tatum propusieron la hipótesis de Un gen & # 8211 Una enzima que establece que un gen controla la producción de una enzima.

Pregunta 2.
Diferenciar nucleósido de nucleótido.
Respuesta:

  1. Nucleósido: la subunidad de nucleósido está compuesta de bases nitrogenadas unidas a una molécula de azúcar pentosa.
  2. Nucleótido: la subunidad de nucleótidos está compuesta por bases nitrogenadas, un azúcar pentosa y un grupo fosfato.

Pregunta 3.
Indique las diferencias clave entre el ADN y el ARN.
Respuesta:
ADN:

  1. El ADN está hecho de azúcar desoxirribosa.
  2. Las bases nitrogenadas del ADN son adenina, guanina, citosina y timina.
  1. El ARN está hecho de azúcar ribosa.
  2. Las bases nitrogenadas del ARN son adenina, guanina, citosina y uracilo.

Pregunta 4.
Señale las bases nitrogenadas del ARN.
Respuesta:
Adenina, Guanina, Citosina y Uracilo.

Pregunta 5.
¿Qué hace que el ADN y el ARN sean moléculas ácidas?
Respuesta:
El grupo funcional fosfato (PO4) le da al ADN y al ARN la propiedad de un ácido a pH fisiológico, de ahí el nombre de ácido nucleico.

Pregunta 6.
Qué tipo de vínculo se forma

  1. entre una base de purina y pirimidina?
  2. entre el azúcar pentosa y el nucleótido adyacente?
  1. Las bases de purina y pirimidina están unidas por enlaces de hidrógeno.
  2. El azúcar pentosa está unido al nucleótido adyacente por enlaces fosfodiéster.

Pregunta 7.
El ADN actúa como material genético para la mayoría de los organismos vivos y no el ARN. Da razones para apoyar la afirmación.
Respuesta:

  1. El ARN era reactivo y, por tanto, muy inestable.
  2. Algunas moléculas de ARN actúan como reguladores de genes al unirse al ADN y afectar la expresión de genes.
  3. El uracilo de ARN es menos estable que la timina de ADN.

Pregunta 8.
Nombra dos virus cuyo material genético sea ARN.
Respuesta:

Pregunta 9.
¿Cuáles son las propiedades que debe poseer una molécula para actuar como material genético?
Respuesta:

  1. Autorreplicación
  2. Almacenamiento de informacion
  3. Estabilidad
  4. Variación por mutación

Pregunta 10.
¿Cuántos pares de bases están presentes en una vuelta completa de la hélice de ADN? ¿Cuál es la distancia entre dos pares de bases consecutivos?
Respuesta:
Hay diez pares de bases en cada turno con una distancia de 0,34 x 109 m entre dos pares de bases adyacentes.

Pregunta 11.
¿Qué es un genóforo?
Respuesta:
En procariotas como E. coli, aunque no tienen un núcleo definido, el ADN no está esparcido por toda la célula. El ADN (que tiene carga negativa) se mantiene con algunas proteínas (que tienen cargas positivas) en una región llamada nucleoide. El ADN como nucleoide está organizado en grandes bucles sostenidos por proteínas. El ADN de los procariotas es casi circular y carece de organización de la cromatina, por lo que se denomina genóforo.

Pregunta 12.
¿Qué es el nucleosoma? ¿Cuántos pares de bases hay en un nucleosoma típico?
Respuesta:
El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN.

Pregunta 13.
Expandir y definir NHC
Respuesta:

  1. NHC: proteína cromosómica no histona.
  2. En eucariotas, además de las proteínas histonas, se requiere un conjunto adicional de proteínas para el empaquetamiento de la cromatina a un nivel superior y se denominan proteínas cromosómicas no histonas.

Pregunta 14.
Diferenciar entre heterocromatina y eucromatina.
Respuesta:
Heterocromatina:

  1. La región del núcleo donde la cromatina está suelta y las manchas claras se llama heterocromatina.
  2. Transcripcionalmente inactivo.
  1. La región del núcleo donde la cromatina está compacta y las manchas oscuras se denominan eucromatina.
  2. Transcripcionalmente activo.

Pregunta 15.
¿Cuál es el modelo de replicación del ADN ampliamente aceptado? ¿Quién lo ha probado?
Respuesta:
Modelo de replicación semiconservador. Fue probado por Meselson y Stahl en 1958.

Pregunta 16.
Nombra la sustancia química que recibe el nombre

  1. La ADN polimerasa I también se conoce como enzima de Komberg.
  2. La polinucleótido fosforilasa también se conoce como enzima de Ochoa.

Pregunta 17.
Nombra los distintos tipos de ADN polimerasa procariota. Indique su papel en el proceso de replicación.
Respuesta:

  1. ADN polimerasa I Involucionario en el mecanismo de reparación del ADN
  2. Involucrador de la ADN polimerasa II en el mecanismo de reparación del ADN
  3. Involucionario de la ADN polimerasa III en la replicación del ADN

Pregunta 18.
¿Cuál es la función del desoxi nucleótido trifosfato en la replicación?
Respuesta:
El desoxi nucleótido trifosfato actúa como sustrato y también proporciona energía para la reacción de polimerización.

Pregunta 19.
A continuación se presentan algunos eventos de replicación eucariota. Nombra las enzimas involucradas en el proceso.

  1. Desbobinado de ADN
  2. Unión de fragmentos de Okazaki
  3. Adición de nucleótidos a una nueva hebra.
  4. Corrigiendo la reparación

Pregunta 20.
Diferenciar la hebra principal de la hebra retrasada
Respuesta:
Filamento principal:

Pregunta 21.
¿Qué son los fragmentos de Okazaki?
Respuesta:
Los fragmentos sintetizados de forma discontinua de la hebra rezagada se denominan fragmentos de Okazaki que se unen mediante la enzima ADN ligasa.

Pregunta 22.
¿Qué es una bifurcación de replicación?
Respuesta:
En el punto de origen de la replicación, las helicasas y topoisomerasas (ADN girasa) desenrollan y separan las hebras, formando una estructura en forma de Y llamada horquilla de replicación. Hay dos bifurcaciones de replicación en cada origen.

Pregunta 23.
Aparte de la ADN polimerasa, nombre las otras cuatro enzimas que participaron en la replicación del ADN de la célula eucariota.
Respuesta:
ADN ligasa, topoisomerasa (ADN girasa), helicasa y nucleasa.

Pregunta 24.
¿Quién propuso el dogma central? Escribe su concepto.
Respuesta:
Francis Crick propuso el dogma central en biología molecular que establece que la información genética fluye de la siguiente manera:

Pregunta 25.
Defina la transcripción y nombre la enzima involucrada en este proceso.
Respuesta:
El proceso de copiar información genética de una hebra de ADN en ARN se denomina transcripción. Este proceso tiene lugar en presencia de la ARN polimerasa dependiente de ADN.

Pregunta 26.
¿Qué es la caja TATA? Indique su función.
Respuesta:
En eucariotas, el promotor tiene regiones ricas en AT llamadas caja TATA o caja Goldberg-Hogness. Actúa como un sitio de unión para la ARN polimerasa.

Pregunta 27.
El gen estructural de los eucariotas se diferencia de los procariotas. ¿Cómo?
Respuesta:
En eucariotas, el gen estructural es monocistrónico que codifica solo una proteína, mientras que en los procariotas, el gen estructural es policistrónico que codifica muchas proteínas.

Pregunta 28.
¿Cuáles son los dos componentes principales de la ARN polimerasa procariota? ¿Cómo actúan?
Respuesta:
La ARN polimerasa bacteriana (procariota) consta de dos componentes principales, la enzima central y la subunidad sigma. La enzima central (β1, β y α) es responsable de la síntesis de ARN & # 8221, mientras que una subunidad sigma es responsable del reconocimiento del promotor.

Pregunta 29.
Distinguir entre exones e intrones.
Respuesta:

  1. Exones: secuencias expresadas (secuencias codificantes) de un gen eucariota
  2. Intrones: secuencias intervinientes (secuencias no codificantes) de un gen eucariota

Pregunta 30.
Definir empalme.
Respuesta:
El proceso de eliminación de intrones del hnRNA se llama empalme.

Pregunta 31.
¿Qué es tapping y tailing?
Respuesta:
Para tapar un nucleótido inusual, se agrega metil guanosina trifosfato en el extremo 5 'del hnRNA, mientras que los residuos de adenilato (200-300) (Poli A) se agregan en el extremo 3' de la cola.

Pregunta 32.
Si un ADN de doble hebra tiene un 20% de citosina, calcule el porcentaje de adenina en el ADN.
Respuesta:
Cytdsine = 20, por lo tanto, guanina = 20
Según la regla de Chargaf (A + T) = (G + C) = 100
Porcentaje de timina + adenina = 20 + 20 = 100
(T + A) = (20 + 20) = 100
(T + A) = 100- (20 + 20)
T + A = 100 y # 8211 40
T + A = 60
Por lo tanto, el porcentaje de adenina será 60/2 = 30%.

Pregunta 33.
Mencione las funciones duales de AUG.
Respuesta:
AUG tiene funciones duales. Actúa como un codón iniciador y también codifica el aminoácido metionina.

Pregunta 34.
¿Cuántos codones están implicados en la terminación de la traducción? Nómbralos.
Respuesta:
Tres codones terminan el proceso de traducción. Son UAA, UAG y UGA.

Pregunta 35.
Degeneración del codón & # 8211 comentario.
Respuesta:
Un código degenerado significa que más de un codón triplete podría codificar un aminoácido específico. Por ejemplo, codones GUU, GUC, GUA y código GUG para valina.

Pregunta 36.
Señale las categorías excepcionales a la universalidad del código genético.
Respuesta:
Se observan excepciones a la naturaleza universal del código genético en genomas de cloroplasto y mitocondrias procariotas.

Pregunta 37.
¿Qué son los codones sin sentido?
Respuesta:
UGA, UAA y UAG son los codones sin sentido, que terminan la traducción.

Pregunta 38.
Nombra los codones triplete que codifican

Pregunta 39.
¿Por qué el hnRNA tiene que someterse a un empalme?
Respuesta:
Dado que el ARNh contiene tanto secuencias codificantes (exones) como secuencias no codificantes (intrones), debe someterse a un corte y empalme para eliminar los intrones.

Pregunta 40.
Indique el papel de los siguientes codones en el proceso de traducción.

Pregunta 41.
A continuación se muestra la secuencia de ARNm. Mencione la secuencia de aminoácidos que se forma después de su traducción.
Respuesta:
3’AUGAAAGAUGGGUAA5 ’
Metionina & # 8211 Lisina & # 8211 Ácido aspártico & # 8211 Glicina

Pregunta 42.
Nombra los cuatro codones que codifican la valina.
Respuesta:
GUU, GUC, GUA y GUG.

Pregunta 43.
La secuencia de bases en una de las cadenas de ADN es TAGC ATGAT. Mencione la secuencia de bases en su cadena complementaria.
Respuesta:
La hebra complementaria tiene ATCGTACTA.

Pregunta 44.
¿Por qué el t-ARN se denomina molécula adaptadora?
Respuesta:
La molécula de ARN de transferencia (ARNt) de una célula actúa como un vehículo que recoge los aminoácidos esparcidos por el citoplasma y también lee códigos específicos de moléculas de ARNm. De ahí que se le llame molécula adaptadora.

Pregunta 45.
¿Qué quiere decir con la carga de tRNA? Nombra la enzima involucrada en este proceso.
Respuesta:
El proceso de adición de aminoácidos al tRNA se conoce como aminoacilación o carga y el producto resultante se llama aminoacil-tRNA (tRNA cargado). La aminoacilación es catalizada por una enzima aminoacil y # 8211 tRNA sintetasa.

Pregunta 46.
¿Qué son las UTR?
Respuesta:
El ARNm también tiene algunas secuencias adicionales que no se traducen y se denominan Regiones no traducidas (UTR). Las UTR están presentes tanto en el extremo 5 '(antes del codón de inicio) como en el extremo 3' (después del codón de terminación).

Pregunta 47.
¿Qué es la secuencia S & # 8211 D?
Respuesta:
El extremo 5 'del ARNm de los procariotas tiene una secuencia especial que precede al codón de inicio AUG inicial del ARNm. Este sitio de unión al ribosoma se denomina secuencia Shine & # 8211 Dalgamo o secuencia S-D. Esta secuencia pares de bases con una región del ARN 16Sr de la subunidad ribosómica pequeña que facilita la iniciación.

Pregunta 48.
Definir unidad de traducción.
Respuesta:
Una unidad de traducción en el ARNm es la secuencia de ARN que está flanqueada por el codón de inicio en el extremo 5 'y el codón de terminación en el extremo 3' y los códigos del polipéptido.

Pregunta 49.
Mencione el papel inhibidor de la tetraciclina y la estreptomicina en la traducción bacteriana.
Respuesta:
La tetraciclina inhibe la unión entre el ARNm de aminoacilo y el ARNm. La estreptomicina inhibe el inicio de la traducción y provoca una lectura incorrecta.

Pregunta 50.
¿En qué etapa se regula la expresión génica?
Respuesta:
La expresión génica puede controlarse o regularse a niveles transcripcionales o traduccionales.

Pregunta 51.
¿Qué es un operón? Da un ejemplo.
Respuesta:
El grupo de genes con funciones relacionadas se llama operón.
Por ejemplo: operón lac en E. coli.

Pregunta 52.
Teniendo en cuenta el operón lac de E. coli, nombre los productos de los siguientes genes.

  1. i gen & # 8211 proteína represora
  2. gen lac Z y # 8211 fS-galactosidasa
  3. Gen Lac Y & # 8211 Permease
  4. lac a gen y # 8211 transacetilasa

Pregunta 54.
Nombra el cromosoma humano que tiene

  1. El cromosoma 1 tiene el número máximo de genes (2968 genes)
  2. El cromosoma Y tiene menos genes (231 genes)

Pregunta 55.
¿Qué son los SNP? Mencione sus usos.
Respuesta:
SNP: polimorfismo de un solo nucleótido. Ayuda a encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 56.
Mencione cuatro áreas en las que se pueden utilizar las huellas dactilares de ADN.
Respuesta:

  1. Análisis forense
  2. Análisis de pedigrí
  3. Conservación de la vida salvaje
  4. Estudios antropológicos

Pregunta 57.
Clasifica el ácido nucleico según las moléculas de azúcar.
Respuesta:
Hay dos tipos de ácidos nucleicos según el tipo de azúcar pentosa. Los que contienen azúcar desoxirribosa se denominan ácido desoxirribonucleico (ADN) y los que contienen azúcar ribosa se conocen como ácido ribonucleico (ARN). La única diferencia entre estos dos azúcares es que hay un átomo de oxígeno menos en la desoxirribosa.

Pregunta 58.
Tanto las purinas como las pirimidinas son bases nitrogenadas, pero difieren. ¿Cómo?
Respuesta:
Tanto las purinas como las pirimidinas son bases nitrogenadas. Las bases de purina adenina y guanina tienen un anillo de nitrógeno de carbono doble y # 8211, mientras que las bases de citosina y timina tienen un anillo de nitrógeno de carbono único.

Pregunta 59.
¿En qué se diferencia el 5 'de ADN de su 3'?
Respuesta:
El 5 ’del ADN se refiere al carbono del azúcar al que está unido el grupo funcional fosfato (P04V). El 3 'del ADN se refiere al carbono del azúcar al que está unido un grupo hidroxilo (OH).

Pregunta 60.
Estado de la regla de Chargaff.
Respuesta:
Según Erwin Chargaff,

  1. La adenina se empareja con la timina con dos enlaces de hidrógeno.
  2. La guanina se empareja con la citosina con tres enlaces de hidrógeno.

Pregunta 61.
Químicamente, el ADN es más estable que el ARN & # 8211 Justificar.
Respuesta:
En el ADN, las dos hebras son complementarias, si se separan (desnaturalizan) por calentamiento pueden unirse (renaturalización) cuando se proporciona la condición apropiada. Además, el grupo 2 OH presente en cada nucleótido del ARN es un grupo reactivo que hace que el ARN sea responsable y fácilmente degradable. También se sabe que el ARN es catalítico y reactivo. Por tanto, el ADN es químicamente más estable y químicamente menos reactivo en comparación con el ARN. La presencia de timina en lugar de uracilo en el ADN confiere estabilidad adicional al ADN.

Pregunta 62.
Escriba en forma simple sobre el modo semiconservador de replicación del ADN.
Respuesta:
La replicación semiconservadora fue propuesta por Watson y Crick en 1953. Este mecanismo de replicación se basa en el modelo de ADN. Sugirieron que las dos cadenas de polinucleótidos de la molécula de ADN se desenrollaran y comenzaran a separarse en un extremo. Durante este proceso, se rompen los enlaces de hidrógeno covalentes. La hebra única separada actúa luego como plantilla para la síntesis de una nueva hebra. Posteriormente, cada doble hélice hija lleva una hebra de polinucleótidos de la molécula madre que actúa como molde y la otra hebra se sintetiza nuevamente y es complementaria a la hebra parental.

Pregunta 63.
Dibuja un diagrama simplificado del nucleosoma y etiquétalo.
Respuesta:

Pregunta 64.
¿Qué es una cartilla?
Respuesta:
Un cebador es un tramo corto de ARN. Inicia la formación de una nueva hebra. El cebador produce el extremo 3'-OH en la secuencia de ribonucleótidos, a los que se agregan desoxirribonucleótidos para formar una nueva hebra.

Pregunta 65.
Ambas cadenas de ADN no se copian durante la transcripción. Dar una razon.
Respuesta:
Ambas cadenas de ADN no se copian durante la transcripción por dos razones.

  1. Si ambas cadenas actúan como plantilla, codificarían ARN con diferentes secuencias. Esto, a su vez, codificaría proteínas con diferentes secuencias de aminoácidos. Esto daría como resultado que un segmento de ADN codificara dos proteínas diferentes, lo que complicaría la maquinaria de transferencia de información genética.
  2. Si se produjeran dos moléculas de ARN simultáneamente, se formaría ARN bicatenario complementario entre sí. Esto evitaría que el ARN se traduzca en proteínas.

Pregunta 66.
¿Qué quiere decir con una cadena de plantilla y una cadena de codificación?
Respuesta:
La ARN polimerasa dependiente de ADN cataliza la polimerización en una sola dirección, la hebra que tiene la polaridad 3 '→ 5' actúa como plantilla y se denomina hebra plantilla. La otra hebra que tiene la polaridad 5 '→ 3' tiene la misma secuencia que el ARN (excepto timina en lugar de uracilo) y se desplaza durante la transcripción. Esta hebra se llama hebra codificante.

Pregunta 67.
Nombre los factores que son responsables del inicio y finalización de la transcripción en procariotas.
Respuesta:

  1. El factor sigma es responsable del inicio de la transcripción.
  2. El factor Rho es responsable de la terminación de la transcripción.

Pregunta 68.
Nombra los principales tipos de ARN de procariotas y menciona su función.
Respuesta:
En los procariotas, hay tres tipos principales de ARN: ARNm, ARNt y ARNr. Los tres ARN son necesarios para sintetizar una proteína en una célula. El ARNm proporciona la plantilla, el ARNt aporta aminoácidos y lee el código genético, y los ARNr juegan un papel estructural y catalítico.
durante la traducción.

Pregunta 69.
Definir código genético.
Respuesta:
El orden de los pares de bases a lo largo de la molécula de ADN controla el tipo y el orden de los aminoácidos que se encuentran en las proteínas de un organismo. Este orden específico de pares de bases se llama código genético.

Pregunta 70.
Explica la hipótesis de Wobble.
Respuesta:
La hipótesis de la oscilación es propuesta por Crick (1966) que establece que el anticodón del ARNt tiene la capacidad de oscilar en su extremo 5 'al emparejarse incluso con una base no complementaria del codón de ARNm. & # 8217 De acuerdo con esta hipótesis, en el emparejamiento de codón-anticodón el La tercera base puede no ser complementaria.

La tercera base del codón se llama base de oscilación y esta posición se llama posición de oscilación. El emparejamiento de bases real se produce solo en las dos primeras posiciones. La importancia de la hipótesis de Wobbling es que reduce el número de ARNt necesarios para la síntesis de polipéptidos y supera el efecto de la degeneración del código.

Pregunta 71.
Explica la naturaleza del ribosoma eucariota.
Respuesta:
Los ribosomas de los eucariotas (80 S) son más grandes y constan de subunidades 60 S y 40 S. "S" denota la sedimentación eficiente que se expresa como unidad de Svedberg (S). La subunidad más grande en eucariotas consiste en una molécula de ARN 23 S y ARN 5Sr y 31 proteínas ribosómicas. La subunidad eucariota más pequeña consta de un componente de ARN 18Sr y aproximadamente 33 proteínas.

Pregunta 72.
Expanda y defina ORF.
Respuesta:
Cualquier secuencia de ADN o ARN que comience con un codón de inicio y que pueda traducirse en una proteína se conoce como marco de lectura abierto (ORF).

Pregunta 73.
¿Cuáles son los componentes del complejo de iniciación de la traducción procariota?
Respuesta:
El inicio de la traducción en E. coli comienza con la formación de un complejo de iniciación, que consta de las subunidades 30S del ribosoma, un ARN mensajero y el ARNt de N-formil metionina cargado (f met -1 ARN f met), tres factores de iniciación proteicos (IF 1, IF2, IF3), GTP (Trifosfato Guaniner) y Mg 2+.

Pregunta 74.
Explica los componentes del operón.
Respuesta:
Estructura del operón: cada operón es una unidad de expresión y regulación génica y consta de
de uno o más genes estructurales y un gen operador adyacente que controla la transcripción
actividad del gen estructural.

  1. El gen estructural codifica proteínas, rRNA y tRNA requeridos por la célula.
  2. Los promotores son las secuencias señal en el ADN que inician la síntesis de ARN. La ARN polimerasa I se une al promotor antes del inicio de la transcripción.
  3. Los operadores están presentes entre los promotores y los genes estructurales. La proteína represora se une a la región operadora del operón.

Pregunta 75.
Describe el experimento de Hershey y Chase. ¿Qué concluye su experimento?
Respuesta:
Alfred Hershey y Martha Chase (1952) realizaron experimentos con bacteriófagos que infectan bacterias. Fago T2 es un virus que infecta a la bacteria Escherichia coli.Cuando se agregan fagos (virus) a las bacterias, se adsorben en la superficie exterior, parte del material ingresa a la bacteria y luego cada bacteria se lisa para liberar una gran cantidad de fagos de la progenie. Hershey y Chase querían observar si era el ADN o la proteína lo que entraba en la bacteria. Todos los ácidos nucleicos contienen fósforo y azufre (en el aminoácido cisteína y metionina). Hershey y Chase diseñaron un experimento utilizando isótopos radiactivos de azufre (35 S) y fósforo (32 P) para realizar un seguimiento separado de la proteína viral y los ácidos nucleicos durante el proceso de infección.

Se permitió que los fagos infectaran bacterias en un medio de cultivo que contenía los isótopos radiactivos 35 S o 32 P. El bacteriófago que creció en presencia de 35 S tenía proteínas marcadas y los bacteriófagos cultivados en presencia de 32 P tenían ADN marcado. Por tanto, el marcaje diferencial les permitió identificar el ADN y las proteínas del fago. Hershey y Chase mezclaron los fagos marcados con E. coli sin marcar y permitieron que los bacteriófagos atacaran e inyectaran su material genético. Poco después de la infección (antes de la lisis de las bacterias), las células bacterianas se agitaron suavemente en un mezclador para aflojar las partículas de la fase adherida.

Se observó que solo se encontró 32 P asociado con células bacterianas y 35 S en el medio circundante y no en las células bacterianas. Cuando se estudió la radioactividad de la progenie del fago, se encontró que solo portaba 32 P y no 35 S. Estos resultados indican claramente que solo el ADN y no la cubierta proteica ingresaron a las células bacterianas. Así, Hershey y Chase demostraron de manera concluyente que era el ADN, no la proteína, lo que transportaba la información hereditaria de virus a bacterias.

Pregunta 76.
Explica las propiedades del ADN que lo convierten en un material genético ideal.
Respuesta:
1. Autorreplicación: debería poder replicarse. De acuerdo con la regla de apareamiento y complementariedad de bases, ambos ácidos nucleicos (ADN y ARN) tienen la capacidad de dirigir duplicaciones. Las proteínas no cumplen con este criterio.

2. Estabilidad: Debe ser estable estructural y químicamente. El material genético debe ser lo suficientemente estable como para no cambiar con las diferentes etapas del ciclo de vida, la edad o con los cambios en la fisiología del organismo. La estabilidad como propiedad del material genético era claramente evidente en el principio transformador de Griffith. El calor que mató a las bacterias no destruyó algunas de las propiedades del material genético. En el ADN, las dos hebras son complementarias.

si se separan (desnaturalizan) por calentamiento, pueden unirse (renaturalización) cuando se proporcionan las condiciones adecuadas. Además, el grupo 2 ’OH presente en cada nucleótido del ARN es un grupo reactivo que hace que el ARN sea susceptible y fácilmente degradable. También se sabe que el ARN es catalítico y reactivo. Por tanto, el ADN es químicamente más estable y químicamente menos reactivo en comparación con el ARN. La presencia de timina en lugar de uracilo en el ADN confiere estabilidad adicional al ADN.

3. Almacenamiento de información: debe poder expresarse en forma de "caracteres mendelianos". El ARN puede codificar directamente la síntesis de proteínas y puede expresar fácilmente los caracteres. El ADN, sin embargo, depende del ARN para la síntesis de proteínas. Tanto el ADN como el ARN pueden actuar como material genético, pero el ADN, que es más estable, almacena la información genética y el ARN transfiere la información genética.

4. Variación por mutación: debería poder mutar. Tanto el ADN como el ARN pueden mutar. El ARN es inestable y muta a un ritmo más rápido. Por lo tanto, los virus que tienen un genoma de ARN con una vida útil más corta pueden mutar y evolucionar más rápido. La discusión anterior indica que tanto el ARN como el ADN pueden funcionar como material genético. El ADN es más estable y se prefiere para el almacenamiento de información genética.

Pregunta 77.
¿Cómo se empaqueta el ADN en una célula eucariota? pie
Respuesta:
En eucariotas, la organización es más compleja. La cromatina está formada por una serie de unidades repetidas llamadas nucleosomas. Komberg propuso un modelo para el nucleosoma, en el que 2 moléculas de las cuatro proteínas histonas H2A, H2B, H3 y H4 se organizan para formar una unidad de ocho moléculas llamada histona octamere. El ADN cargado negativamente se envuelve alrededor del octamero de histonas cargadas positivamente para formar una estructura llamada nucleosoma. Un nucleosoma típico contiene 200 pb de hélice de ADN. Los octameros de histonas están en estrecho contacto y el ADN está enrollado en el exterior del nucleosoma. Los nucleosomas vecinos están conectados por ADN enlazador (HI) que está expuesto a enzimas.

El ADN hace dos vueltas completas alrededor de los octameros de histona y las dos vueltas están selladas por una molécula de HI. La cromatina que carece de HI tiene una apariencia de perlas en una cuerda en la que el ADN se interpone y abandona los nucleosomas en lugares aleatorios. El HI de un nucleosoma puede interactuar con 33 l de los nucleosomas vecinos dando como resultado un mayor plegamiento de la fibra.

La fibra de crof y ampatina en núcleos en interfase y cromosomas mitóticos tiene un diámetro que varía entre 200-300 nm y representa cromatina inactiva. La fibra de 30 nm surge del plegamiento de nucfeosbme, cadenas en una estructura de solenoide que tiene seis nucleosomas por vuelta. Esta estructura se estabiliza mediante la interacción entre diferentes moléculas de HI. El ADN es un solenoide y está empaquetado,%) _ pliegues. Se ilustra la naturaleza jerárquica de la estructura cromosómica.

Se requiere un conjunto adicional de pteínas para el empaquetamiento de cromatina a un nivel superior y se denominan proteínas cromosómicas no histonas (NHC). En *, un núcleo típico, algunas regiones de la cromatina están empaquetadas con Ibosely (ligeramente teñidas) y se las conoce como eucromatina. La cromatina que está compactada (teñida de forma oscura) se llama heterocromatina. La eucromatina es transcripcionalmente activa y la heterocromatina es transcripcionalmente inactiva.

Pregunta 78.
El experimento de Meselson y Stahl demostró el modo de replicación del ADN de semicofptervación. Explicar.
Respuesta:
El modo de replicación del ADN fue determinado en 1958 por Meselson y Stahl. Diseñaron un experimento para distinguir entre réplicas semiconservadoras, conservadoras y dispersivas. En su experimento, cultivaron dos cultivos de E. coli durante muchas generaciones en medios separados. El cultivo "pesado" se hizo crecer en un medio en el que la fuente de nitrógeno (NH4CI) contenía el isótopo pesado 15 N y el cultivo "ligero" se cultivó en un medio en el que la fuente de nitrógeno contenía el isótopo ligero 14 H durante muchas generaciones. Al final del crecimiento, observaron que el ADN bacteriano en el cultivo pesado contenía solo 15 N y en el cultivo ligero solo 14 N. El ADN pesado se pudo distinguir del ADN ligero (15 N de 14 N) con una técnica llamada Cesio. Centrifugación en gradiente de densidad de cloruro (CsCl). En este proceso, el ADN pesado y liviano extraído de las células en trece cultivos se asentaron en dos bandas distintas y separadas (ADN híbrido).

El cultivo pesado (15 N) se transfirió luego a un medio que solo tenía NH4Cl y se tomaron muestras en varios intervalos de tiempo definidos (20 minutos de duración). Después de la primera replicación, extrajeron el ADN y lo sometieron a centrifugación en gradiente de densidad. El ADN se instaló en una banda que tenía una posición intermedia entre las bandas pesadas y ligeras determinadas previamente. Después de la segunda replicación (40 minutos de duración), nuevamente extrajeron muestras de ADN, y esta vez encontraron que el ADN se asentaba en dos bandas, una en la posición de la banda clara y otra en la posición intermedia. Estos resultados confirman la hipótesis de replicación semi & # 8211 conservadora de Watson y Crick.

Pregunta 79.
Dar una descripción detallada de una unidad de transcripción.
Respuesta:
Una unidad transcripcional en el ADN está definida por tres regiones, un promotor, el gen estructural y un terminador. El promotor se encuentra hacia el extremo 5 '. Es una secuencia de ADN que proporciona un sitio de unión para la ARN polimerasa. La presencia de promotor en una unidad de transcripción define la plantilla y las cadenas codificantes. La región del terminador ubicada hacia el extremo 3 'de la cadena codificante contiene una secuencia de ADN que hace que la ARN polimerasa deje de transcribir. En eucariotas, el promotor tiene regiones ricas en AT llamadas caja TATA (caja de Goldberg-Hogness) & # 8216 y en procariotas esta región se llama caja de Pribnow.

Además del promotor, los eucariotas también requieren un potenciador. Las dos hebras del ADN en el gen estructural de una unidad de transcripción tienen polaridad opuesta. La ARN polimerasa dependiente de ADN cataliza la polimerización en una sola dirección, la hebra que tiene la polaridad 3 '→ 5' actúa como plantilla y se denomina hebra plantilla. La otra hebra que tiene la polaridad 5 '→ 3' tiene la misma secuencia que el ARN (excepto timina en lugar de uracilo) y se desplaza durante la transcripción. Esta hebra se llama hebra codificante

El gen estructural puede ser monocistrónico (eucariotas) o policistrónico (procariotas). En eucariotas, cada ARNm lleva solo un gen y codifica información para una sola proteína y se llama ARNm monocistrónico. En los procariotas, los grupos de genes relacionados, conocidos como operón, que a menudo se encuentran uno al lado del otro en el cromosoma, se transcriben juntos para dar un solo ARNm y, por lo tanto, son policistrónicos.

Pregunta 80.
Explique el proceso de transcripción en procariotas con el diagrama necesario.
Respuesta:
En los procariotas, hay tres tipos principales de ARN:
ARNm, ARNt y ARNr. Los tres ARN son necesarios para sintetizar una proteína en una célula. El ARNm proporciona la plantilla, el ARNt aporta aminoácidos y lee el código genético, y los ARNr desempeñan un papel estructural y catalítico durante la traducción. Existe una única ARN polimerasa dependiente de ADN que cataliza la transcripción de todos los tipos de ARN. Se une al promotor e inicia la transcripción (iniciación).

Los sitios de unión de las polimerasas se denominan promotores. Utiliza nucleósido trifosfato como sustrato y polimerasas de forma dependiente de la plantilla siguiendo la regla de complementariedad. Después del inicio de la transcripción, la polimerasa continúa alargando el ARN, agregando un nucleótido tras otro a la cadena de ARN en crecimiento. Solo un tramo corto de ARN permanece unido a la enzima, cuando la polimerasa alcanza un terminador al final de un gen, el ARN naciente se cae, y también la ARN polimerasa. La ARN polimerasa solo es capaz de catalizar el proceso de alargamiento. La ARN polimerasa se asocia transitoriamente con el factor de iniciación sigma (a) y el factor de terminación rho (p) para iniciar y terminar la transcripción, respectivamente.

La asociación de ARN con estos factores instruye a la ARN polimerasa para iniciar o terminar el proceso de transcripción. En las bacterias, dado que el ARNm no requiere ningún procesamiento para activarse y también dado que la transcripción y la traducción tienen lugar simultáneamente en el mismo compartimento (ya que no hay separación del citosol y el núcleo en las bacterias), muchas veces la traducción puede comenzar mucho antes de que el ARNm sea eliminado. totalmente transcrito. Esto se debe a que el material genético no está separado de otros orgánulos celulares por una membrana nuclear, por lo que la transcripción y la traducción pueden acoplarse en bacterias.

Pregunta 81.
Escribe las características más destacadas del código genético.
Respuesta:
Las características más destacadas del código genético son las siguientes:

  1. El codón genético es un código triplete y 61 codones codifican aminoácidos y 3 codones no codifican ningún aminoácido y funcionan como codón de terminación (terminación).
  2. El código genético es universal. Significa que todos los sistemas vivos conocidos utilizan ácidos nucleicos y los mismos codones de tres bases (codón triplete) dirigen la síntesis de proteínas a partir de aminoácidos. Por ejemplo, el codón del ARNm (UUU) codifica la fenilalanina en todas las células de todos los organismos. Se informan algunas excepciones en genomas procarióticos, mitocondriales y de cloroplasto. Sin embargo, las similitudes son más comunes que las diferencias.
  3. Un codón no superpuesto significa que no se usa la misma letra para dos codones diferentes. Por ejemplo, la secuencia de nucleótidos GUTJ y GUC representa solo dos codones.
  4. No tiene comas, lo que significa que el mensaje se leería directamente de un extremo al otro, es decir, no se necesitan signos de puntuación entre dos códigos.
  5. Un código degenerado significa que más de un codón triplete podría codificar un aminoácido específico. Por ejemplo, codones GUU, GUC, GUA y código GUG para valina.
  6. El código no ambiguo significa que un codón codificará un aminoácido.
  7. El código siempre se lee en una dirección fija, es decir, desde 5 '→ 3' dirección llamada polaridad.
  8. AUG tiene funciones duales. Actúa como un codón iniciador y también codifica el aminoácido metionina.
  9. Los codones UAA, UAG (tirosina) y UGA (triptófano) se designan como codones de terminación (terminación) y también se conocen como codones "sin sentido".

Pregunta 82.
Las mutaciones en el código genético afectan el fenotipo. Describe con un ejemplo.
Respuesta:
El tipo más simple de mutación a nivel molecular es un cambio de nucleótido que sustituye una base por otra. Tales cambios se conocen como sustituciones de bases que pueden ocurrir espontáneamente o debido a la acción de mutágenos. Un ejemplo bien estudiado es la anemia de células falciformes en humanos, que resulta de una mutación puntual de un alelo del gen de la β-hemoglobina (βHb).

Una molécula de hemoglobina consta de cuatro cadenas polipeptídicas de dos tipos, dos cadenas a y dos cadenas P. Cada cadena tiene un grupo hemo en su superficie. Los grupos hemo están involucrados en la unión de oxígeno. La enfermedad de la sangre de Jruman, la anemia de células falciformes, se debe a una hemoglobina anormal. Esta anomalía en la hemoglobina se debe a una sustitución de una sola base en el sexto codón del gen beta globingen de GAG ​​a GTG en la cadena p de la hemoglobina.

Da como resultado un cambio del aminoácido ácido glufeniico a valina en la sexta posición de la cadena p. Este es el ejemplo clásico de mutación puntual que da como resultado el cambio del residuo de aminoácidos ácido glutámico a valina. La hemoglobina mutante sufre una polimerización bajo tensión de oxígeno provocando el cambio en la forma de los glóbulos rojos de bicóncava a una estructura en forma de hoz.

Pregunta 83.
Explique el mecanismo de AteArperon de la E-coli.
Respuesta:
El operón Lac (lactosa): el metabolismo de la lactosa en E. coli requiere tres enzimas: permeasa, P-galactosidasa (P-gat) y transacetilasa. La enzima permeasa es necesaria para la entrada de lactosa en la célula, la Pjgglactosidasa provoca la hidrólisis de lactosa a glucosa y galactosa, mientras que la transacetilatransfiere el grupo acetilo de acetil Co A a P-galactosidasa. El operón lac consta de un gen regulador (el gen T se refiere al inhibidor), sitios promotores (p) y sitios operadores (o). Además de estos, tiene tres genes estructurales a saber, lac z, y y lac a. El gen lac "z" codifica la P-gaiaqtttsidasa, el gen lac "y" codifica la permeasa y el gen "a" codifica la transacetilasa.

Jacob y Monod propusieron el modelo clásico del operón Lac para explicar la expresión y regulación génica en E. coli. En lac, un gen estructural policistrónico está regulado por un promotor común y genfc regulador. Cuando la célula usa su fuente de energía normal como glucosa, el gen "i" transcribe un ARNm represor y, después de su traducción, se produce una proteína represora. Se une a la región operadora del operón e impide la traducción, como resultado, no se produce P-galactosidasa. En ausencia de una fuente de carbono preferida, como la glucosa, si la lactosa está disponible como fuente de energía para las bacterias, la lactosa entra en la célula como resultado de la enzima permeasa. La lactosa actúa como inductor e interactúa con el represor para inactivarlo.

La proteína represora se une al operador del operón y evita que la ARN polimerasa transcriba el operón. En presencia de un inductor, como lactosa o alolactosa, el represor se inactiva por interacción con el inductor. Esto permite que la ARN polimerasa se una al sitio del promotor y transcriba el operón para producir ARNm de lac que permite la formación de todas las enzimas necesarias para el metabolismo de la lactosa. Esta regulación del operón lac por el represor es un ejemplo de control negativo del inicio de la transcripción.

Pregunta 84.
¿Cuáles son los objetivos del proyecto Genoma Humano?
Respuesta:
Los principales objetivos del Proyecto Genoma Humano son los siguientes:

  1. Identifique todos los genes (aproximadamente 30000) en el ADN humano.
  2. Determine la secuencia de los tres mil millones de pares de bases químicas que componen el ADN humano.
  3. Almacenar esta información en bases de datos.
  4. Mejorar las herramientas para el análisis de datos.
  5. Transferir tecnologías relacionadas a otros sectores, como industrias.
  6. Abordar las cuestiones éticas, legales y sociales (ELSI) que puedan surgir del proyecto.

Pregunta 85.
Escribe las características más destacadas del Proyecto Genoma Humano.
Respuesta:

  1. Aunque el genoma humano contiene 3 mil millones de bases de nucleótidos, las secuencias de ADN que codifican proteínas constituyen solo alrededor del 5% del genoma.
  2. Un gen promedio consta de 3000 bases, el gen humano más grande conocido es la distrofina con 2,4 millones de bases.
  3. La función del 50% del genoma se deriva de elementos transponibles como la secuencia LINE y ALU.
  4. Los genes se distribuyen en 24 cromosomas. El cromosoma 19 tiene la mayor densidad genética. El cromosoma 13 y el cromosoma Y tienen las densidades de genes más bajas.
  5. La organización cromosómica de los genes humanos muestra diversidad.
  6. Puede haber 35000-40000 genes en el genoma y casi 99,9 bases de nucleótidos son exactamente iguales en todas las personas.
  7. Se desconocen las funciones de más del 50 por ciento de los genes descubiertos.
  8. Menos del 2 por ciento del genoma codifica proteínas.
  9. Las secuencias repetidas constituyen una gran parte del genoma humano. Las secuencias repetitivas no tienen funciones de codificación directa, pero arrojan luz sobre la estructura, dinámica y evolución de los cromosomas (diversidad genética).
  10. El cromosoma 1 tiene 2968 genes, mientras que el cromosoma 'Y' tiene 231 genes.
  11. Los científicos han identificado alrededor de 1,4 millones de ubicaciones, donde las diferencias de ADN de una sola base (SNP & # 8211 Polimorfismo de nucleótido único & # 8211 se pronuncia como "snips") ocurren en humanos. La identificación de "SNIPS" es útil para encontrar ubicaciones cromosómicas para secuencias asociadas a enfermedades y rastrear la historia humana.

Pregunta 86.
Describe el principio involucrado en la técnica de huellas dactilares de ADN.
Respuesta:
La técnica de huellas dactilares de ADN fue desarrollada por primera vez por Alec Jeffreys en 1985. El ADN de una persona y las huellas dactilares son únicos. Hay 23 pares de cromosomas humanos con 1,5 millones de pares de genes. Es un hecho bien conocido que los genes son segmentos de ADN que difieren en la secuencia de sus nucleótidos. No todos los segmentos de ADN codifican proteínas, algunos segmentos de ADN tienen una función reguladora, mientras que otros son secuencias intermedias (intrones) y otros son secuencias de ADN repetidas. En la toma de huellas dactilares de ADN, las secuencias de nucleótidos cortas y repetitivas son específicas de una persona. Estas secuencias de nucleótidos se denominan repeticiones en tándem de número variable (VNTR). Los VNTR de dos personas generalmente muestran variaciones y son útiles como marcadores genéticos.

La impresión digital de ADN implica identificar diferencias en algunas regiones específicas de la secuencia de ADN llamadas ADN repetitivo, porque en estas secuencias, un pequeño tramo de ADN se repite muchas veces. Este ADN repetitivo se separa del ADN genómico en masa como picos diferentes durante la centrifugación en gradiente de densidad. El ADN a granel forma un pico principal y los otros picos pequeños se denominan ADN satélite. Dependiendo de la composición de la base (rica en A: T o rica en G: C), la longitud del segmento y el número de unidades repetitivas, el ADN del satélite se clasifica en muchas subcategorías como microsatélites y minisatélites, etc.

Estas secuencias no codifican ninguna proteína, pero forman una gran parte del genoma humano. Estas secuencias muestran un alto grado de polimorfismo y forman la base de las huellas dactilares del ADN. El ADN aislado de sangre, cabello, células de la piel u otras evidencias genéticas dejadas en la escena de un crimen se puede comparar a través de patrones VNTR, con el ADN de un sospechoso criminal para determinar la culpabilidad o inocencia. Los patrones VNTR también son útiles para establecer la identidad de una víctima de homicidio, ya sea a partir del ADN encontrado como evidencia o del propio cuerpo.

Pregunta 87.
Dibuje un diagrama de flujo que represente los pasos de la técnica de huellas dactilares de ADN
Respuesta:

Preguntas sobre habilidades de pensamiento de orden superior (HOT)

Pregunta 1.
Una hebra de ARNm tiene una serie de codones tripletes, de los cuales los primeros tres codones se dan a continuación.
(a) AGOSTO
(b) UUU
(c) CGU
(i) Nombre el aminoácido codificado por estos codones triplete.
(ii) ¿Menciona la secuencia de ADN a partir de la cual se habrían transcrito estos tripletes de codones?
Respuesta:
(i) Códigos AUG para metionina
Códigos UUU para fenilalanina
Códigos UGC para cisteína
(ii) La secuencia de ADN de TAC se transcribe a AUG
La secuencia AAA de ADN se transcribe a UUU
La secuencia de ADN de ACG se transcribe a UGC

Pregunta 2.
A continuación se muestran las estructuras de las moléculas de ARNt que participan en el proceso de traducción. En un ARNt, se menciona el codón pero no el aminoácido. En otra molécula de ARNt, se nombra el aminoácido y no el codón. Complete la figura mencionando los respectivos aminoácidos y codones.
Respuesta:

Pregunta 3.
Un fragmento de ADN posee 32 bases de adenina y 32 bases de citosina. ¿Cuántos nucleótidos en total contiene ese fragmento de ADN? Explicar.
Respuesta:
128 nucleótidos. Adenine siempre empareja la base de Thymine. Si hay 32 bases de adenina, entonces debe haber 32 bases de timina. De manera similar, la citosina se empareja con la guanina. Si las bases de citosina son 32 en número, las bases de guanina serán iguales a la citosina. Entonces hace un total de 128 nucleótidos.

Pregunta 4.
A continuación se muestra una secuencia de ADN que representa una parte del gen TAC TCG CCC TAT UAA CCC AAA ACC TCT utilizando esta derivación A.


Buscador de ORF:

El buscador de ORF es un programa disponible en el sitio web de NCBI. Identifica todos los marcos de lectura abiertos o la posible región codificadora de proteínas en secuencia. Muestra 6 barras horizontales correspondientes a uno de los posibles marcos de lectura. En cada dirección del ADN habría 3 posibles marcos de lectura. Entonces, un total de 6 marcos de lectura posibles (6 barras horizontales) estaría allí para cada secuencia de ADN. Los 6 marcos de lectura posibles son +1, +2, +3 y -1, -2 y -3 en la hebra inversa. Los aminoácidos resultantes se pueden guardar y buscar en varias bases de datos de proteínas utilizando blast para encontrar secuencias o aminoácidos similares. El resultado muestra la posible secuencia de proteínas y la longitud del marco de lectura abierto, etc.


Descubrimiento clave sobre cómo se activan y desactivan los genes - & # 8220 Implicaciones críticas para la salud humana & # 8221

Los cuerpos humanos tienen aproximadamente 30.000 genes que dictan no solo cómo nos vemos, sino también procesos biológicos críticos. Ahora, un equipo de investigación de la Universidad Estatal de Florida y la Universidad Nacional de Australia ha descubierto un aspecto clave de la regulación genética y, en última instancia, cómo ese proceso está implicado en el cáncer.

Jonathan Dennis, profesor asociado de ciencias biológicas en FSU, y David Tremethick, profesor de la Universidad Nacional de Australia, han publicado un nuevo artículo en Comunicaciones de la naturaleza que revela información clave sobre la región de control de un gen, donde las proteínas se unen para activar o desactivar los genes. Los investigadores encontraron que la forma en que se empaqueta esta región dicta cómo se expresan o se restringen los genes.

El empaque se refiere a todas las características de cómo y dónde se unen estas proteínas. Ese proceso es fundamental para la biología humana, señaló Dennis.

"Cuando se une lo incorrecto, se obtiene una fisiología inapropiada, en algunos casos, cáncer", dijo.

La nueva información desafía los modelos actuales sobre cómo se expresa un gen al revelar que hay muchas formas diferentes de empaquetar un promotor para permitir o restringir la expresión de un gen.

Una proteína llamada H2A.Z juega un papel importante en la regulación de este empaquetamiento de genes de diferentes formas. Los investigadores encontraron que una función importante de H2A.Z en la regulación de genes es garantizar que solo los factores reguladores adecuados tengan acceso a los promotores de genes.

"H2A.Z es un tipo de proteína llamada variante de histona", dijo Lauren Cole, ex estudiante de doctorado de la FSU y primera autora del artículo. "Debido a que las variantes de histonas juegan un papel importante en la regulación de genes, este trabajo conduce a una mayor comprensión del genoma humano".

Tremethick dijo que el hallazgo subraya cuánto trabajo queda por hacer para comprender el genoma humano y cómo este hallazgo puede hacer avanzar el campo.

“Aunque han pasado casi 20 años desde que se secuenció el genoma humano, aún no se comprende bien cómo esta información genómica se utiliza selectivamente para dirigir los patrones de expresión génica que sustentan las decisiones sobre el destino celular”, dijo Tremethick. "Si bien todavía queda mucho trabajo por hacer, nuestro estudio ayudará a avanzar en el campo para comprender mejor cómo se expresan nuestros genes en el momento y lugar adecuados, lo que tiene implicaciones críticas para la salud humana".

Referencia: & # 8220 Funciones múltiples de H2A.Z en la regulación de la arquitectura de cromatina promotora en células humanas & # 8221 por Lauren Cole, Sebastian Kurscheid, Maxim Nekrasov, Renae Domaschenz, Daniel L. Vera, Jonathan H. Dennis y David J. Tremethick, 5 de mayo 2021, Comunicaciones de la naturaleza.
DOI: 10.1038 / s41467-021-22688-x

Otros autores del artículo son Sebastian Kurscheid, Maxim Nekrasov y Renae Domaschen de la Universidad Nacional de Australia, y Daniel Vera, un ex estudiante graduado de la FSU que ahora es investigador en la Escuela de Medicina de Harvard.

Más sobre SciTechDaily

El genoma humano a los 20: cómo el avance más publicitado de la biología condujo al anticlímax y a los arrestos

Un estudio de UCLA muestra que las lesiones en la cabeza pueden alterar cientos de genes

MIT & # 8217s Mapa completo del genoma del SARS-CoV-2 y análisis de casi 2000 mutaciones de COVID

& # 8220Area X & # 8221 de Zebra Finch puede proporcionar información sobre los trastornos del habla humana

¿Son los genes masculinos de Marte, los genes femeninos de Venus? Diferencias de sexo en salud y enfermedad

Los genes "ocultos" en los bacteriófagos podrían ser clave en el desarrollo de nuevos antibióticos

El potencial y los peligros de CRISPR: ¿Vale la pena correr el riesgo de CRISPR?

Uso del pez cebra para descifrar las funciones de los genes asociados con el autismo

2 comentarios sobre "Descubrimiento clave sobre cómo se activan y desactivan los genes - & # 8220 Implicaciones críticas para la salud humana & # 8221"

Babu G. Ranganathan *
(Licenciatura en Biblia / Biología)

¿CÓMO CONVIERTE EL ADN UNA CÉLULA EN UNA OVEJA, O UN PÁJARO O UN HUMANO?

Cuando divides un pastel, el pastel nunca crece. Sin embargo, cuando éramos una sola célula y esa célula seguía dividiéndose, nos hicimos más grandes. El nuevo material tenía que venir de alguna parte. Ese nuevo material vino de la comida.

Así como la secuencia de varias letras y palabras en el lenguaje humano comunica un mensaje y dirige a los trabajadores a construir y ensamblar algo, también la secuencia de varias moléculas en nuestro ADN (nuestros genes o código genético) dirigió las moléculas de nuestra madre & # 8217s alimento, que recibimos en el útero, para convertirse en nuevas células, formando eventualmente todos los tejidos y órganos de nuestro cuerpo.

Cuando alimentas a un gato con tu comida, el ADN del gato dirigirá las moléculas de la comida para que se conviertan en células, tejidos y órganos de un gato, pero tu ADN convertirá la misma comida en células, tejidos y órganos humanos.

Lo que llamamos "genes" son en realidad segmentos de la molécula de ADN. Cuando comprenda cómo funciona su ADN, también comprenderá cómo las yemas de huevo pueden convertirse en pollos. Lea mi popular artículo de Internet: ¿CÓMO ME HIZO MI ADN? Simplemente busque en Google el título para acceder al artículo.

Este artículo le dará una buena comprensión de cómo funciona el ADN, así como la clonación y la ingeniería genética. También aprenderá que el llamado & # 8220 ADN basura & # 8221 no es & # 8217t basura en absoluto. Aprenderá por qué no es racional creer que el código de ADN pudo haber surgido por casualidad. La ciencia apunta (no prueba, pero apunta) a una causa inteligente para el código del ADN.

¿Qué pasa con las similitudes genéticas y biológicas entre especies? La información genética, como otras formas de información, no puede suceder por casualidad, por lo que es más lógico creer que las similitudes genéticas y biológicas entre todas las formas de vida se deben a un Diseñador común que diseñó funciones similares para propósitos similares. ¡No significa que todas las formas de vida estén relacionadas biológicamente! Solo las similitudes genéticas dentro de una especie natural prueban la relación porque solo dentro de una especie natural los miembros pueden cruzarse y reproducirse.

La naturaleza no puede construir un código de ADN desde cero. Requiere un código de ADN ya existente para dirigir y generar más código de ADN o un ingeniero genético en el laboratorio que utilice un diseño inteligente y tecnología altamente sofisticada para hacer que el código de ADN exista desde cero. Además, el ARN / ADN y las proteínas son mutuamente dependientes (uno no puede existir sin los otros dos) y no pueden & # 8220supervivir & # 8221 o funcionar fuera de una célula viva y completa. ¡El código de ADN debe su existencia al primer ingeniero genético & # 8211 Dios!

Las moléculas de proteína requieren que varios aminoácidos se unan en una secuencia precisa, al igual que las letras en una oración. Si no están en la secuencia correcta, la proteína no funcionará. El ADN y el ARN requieren que varios de sus diversos ácidos nucleicos estén en la secuencia correcta.

Además, hay aminoácidos zurdos y diestros y hay ácidos nucleicos zurdos y diestros. Las moléculas de proteína requieren que todos sus aminoácidos sean solo para zurdos y en la secuencia correcta. El ADN y el ARN requieren que todos sus ácidos nucleicos sean diestros y estén en la secuencia correcta. ¡Se necesitaría un milagro para que el ADN, el ARN y las proteínas surgieran por casualidad!

¡Los matemáticos han dicho que cualquier evento en el universo con probabilidades de 10 a 50 o más es imposible! La probabilidad de que surja por casualidad una molécula de proteína de tamaño medio (con sus aminoácidos en la secuencia correcta) es de 10 elevado a 65. Incluso la célula más simple está formada por muchos millones de diversas moléculas de proteínas junto con ADN / ARN.

El difunto gran científico británico Sir Frederick Hoyle calculó que las probabilidades de que incluso la célula más simple llegue a existir por casualidad es de 10 elevado a 40.000. ¿Qué tan grande es esto? Considere que el número total de átomos en nuestro universo es de 10 elevado a 82.

Además, el llamado & # 8220Junk DNA & # 8221 no es & # 8217t basura. Aunque estos segmentos de ADN & # 8220 no codificantes & # 8221 de ADN no codifican proteínas, recientemente se ha descubierto que son vitales para regular la expresión génica (es decir, cuándo, dónde y cómo se expresan los genes, por lo que & # 8217 no son & # 8220 basura y # 8221). Además, existe evidencia de que, en determinadas situaciones, pueden codificar proteínas mediante el uso de un mecanismo complejo de "lectura" por parte de la célula.

Visite mi último sitio de Internet: LA CIENCIA QUE APOYA LA CREACIÓN (Este sitio responde a muchos argumentos, tanto antiguos como nuevos, que han sido utilizados por los evolucionistas para apoyar su teoría)

Autor del popular artículo de Internet, DOCTRINA TRADICIONAL DEL INFIERNO EVOLUCIONADO DE LAS RAÍCES GRIEGAS

* He dado conferencias exitosas (con preguntas y respuestas posteriores) defendiendo la creación ante profesores y estudiantes de ciencias evolucionistas en varios colegios y universidades. He tenido el privilegio de ser reconocido en la 24a edición de Marquis & # 8220Who & # 8217s Who in The East. & # 8221


Código de ADN para insulina

A continuación se muestran dos secuencias parciales de bases de ADN (que se muestran solo para una hebra de ADN) La secuencia 1 es de un ser humano y la secuencia 2 es de una vaca. Tanto en humanos como en vacas, esta secuencia es parte de un conjunto de instrucciones para controlar la producción de una proteína. En este caso, la secuencia contiene el gen para producir la proteína insulina. La insulina es necesaria para la absorción de azúcar de la sangre. Sin insulina, una persona no puede usar los azúcares digeridos de la misma manera que otras personas, y tiene una enfermedad llamada diabetes.

  1. Usando la secuencia de ADN dada en la tabla 1, haga una hebra de ARN complementaria para el ser humano. Escriba el ARN directamente debajo de la cadena de ADN (recuerde sustituir las U por las T en el ARN).
  2. Repita el paso 1 para la vaca. Escriba el ARN directamente debajo de la cadena de ADN en la tabla 2.
  3. Usa la tabla de codones de tu libro para determinar qué aminoácidos se ensamblan para producir la proteína de insulina tanto en la vaca como en el ser humano. Escribe tu cadena de aminoácidos directamente debajo de la secuencia de ARN.

Secuencia 1 Humano
ADN C C A T A G C A C G T T A C A A C G T G A A G G T A A
ARN
Aminoácidos

Secuencia 1 Vaca
ADN C C G T A G C A T G T T A C A A C G C G A A G G C A C
ARN
Aminoácidos

1. La secuencia de ADN es diferente para la vaca y el ser humano, pero la cadena de aminoácidos producida por la secuencia es casi la misma. ¿Cómo puede pasar esto?

2. La diabetes es una enfermedad caracterizada por la incapacidad de descomponer los azúcares. A menudo, una persona con diabetes tiene una secuencia de ADN defectuosa que codifica la producción de la proteína insulina. Supongamos que una persona tiene una mutación en su ADN y el primer triplete del gen que codifica la insulina es C C C (en lugar de C C A). Determina qué aminoácido codifica el nuevo triplete de ADN. ¿Esta persona será diabética?

3. ¿Y si el primer triplete fuera C A A?

4. ¿Cómo es posible que un código que consta de solo cuatro letras, como en el ADN (A, T, G, C) pueda especificar todas las diferentes partes de un organismo y dar cuenta de toda la diversidad de organismos en este planeta?

Las secuencias de ADN se utilizan a menudo para determinar las relaciones entre organismos. Las secuencias de ADN que codifican un gen en particular pueden variar ampliamente. Los organismos que están estrechamente relacionados tendrán secuencias similares. A continuación se muestra una lista de secuencias para algunos organismos:

Humano CCA TAG CAC CTA
Cerdo CCA TGG AAA CGA
Chimpancé CCA TAA CAC CTA
Grillo CCT AAA GGG ACG

5. Según las secuencias, ¿qué dos organismos están más estrechamente relacionados?

6. Se encuentra un organismo desconocido en el bosque, y se secuencia el gen, y se determina que es C C A T G G A T C G A, ¿qué tipo de animal crees que es?


Refuerzo de bonos

Los científicos de la Unión Soviética fueron los primeros en descubrir Z-DNA, a fines de la década de 1970, en un fago llamado S-2L, que infecta a las bacterias fotosintéticas 4. Descubrieron que el ADN del fago se comportaba de manera extraña cuando sus dos hebras helicoidales se fundían. El enlace que se forma entre las bases G y C se rompe a una temperatura más alta, en comparación con el que une A y T, y el ADN del fago se comportó como si estuviera hecho principalmente de G y C. Pero un análisis adicional realizado por el equipo soviético mostró que el fago había reemplazado A con Z, lo que formaba un vínculo más fuerte con T.

“Parecía algo transgresor”, dice Philippe Marlière, inventor y genetista de la Universidad de Evry, Francia, quien dirigió uno de los Ciencias estudios. "¿Por qué este fago tiene una base especial como esta?"

Los científicos vislumbran un microbio extraño que podría ayudar a explicar el surgimiento de la vida compleja

Los estudios de seguimiento mostraron que el genoma más fuerte de S-2L era resistente a las enzimas que mastican el ADN y otras defensas antifágicas que ejercen las bacterias. Pero los investigadores no sabían cómo funcionaba el sistema Z-DNA o si era común. El ADN-Z es solo una de una serie de modificaciones que se sabe que existen en el ADN del fago.

Para responder a esas preguntas, un equipo dirigido por Marlière y Pierre-Alexandre Kaminski, bioquímico del Instituto Pasteur de París, secuenció el genoma del fago a principios de la década de 2000. Encontraron un gen que está potencialmente involucrado en un paso de la producción de Z-DNA, pero no en otros. Pero la secuencia no tenía coincidencias en las bases de datos genómicas en ese momento, y la búsqueda del equipo para comprender la base del ADN-Z llegó a un callejón sin salida.

Marlière y sus colegas patentaron el genoma de S-2L, pero también lo hicieron público, y continuó recorriendo las bases de datos genómicas. Finalmente, en 2015, el equipo consiguió un éxito: un fago que infecta bacterias acuáticas del género Vibrio albergaba un gen que coincidía con un tramo del genoma de S-2L. El gen codificaba una enzima que se parecía a la que usan las bacterias para producir adenina. “Fue un momento estimulante”, dice Marlière.

En 2019, el equipo de Zhao encontró coincidencias de bases de datos similares. Ambos equipos demostraron que todos los fagos tenían un gen llamado PurZ. Esto codifica una enzima que juega un papel temprano pero crucial en la producción del nucleótido Z a partir de una molécula precursora que está presente en las células bacterianas. Luego identificaron enzimas adicionales, codificadas en los genomas de las bacterias que infectan los fagos, que completan la ruta.

El arma secreta del ADN contra los nudos y enredos

Pero quedaba una pregunta clave. Las enzimas que identificaron los equipos produjeron el ingrediente crudo para Z-DNA, una molécula llamada dZTP, pero eso no explica cómo los fagos insertan la molécula en las cadenas de ADN, mientras que excluyen las bases A (en forma de una sustancia química llamada dATP).

Aquí, las conclusiones de los equipos difieren ligeramente. Junto a PurZ en el Vibrio El genoma del fago se encuentra en un gen que produce una enzima llamada polimerasa, que copia cadenas de ADN. Marlière y Kaminski encontraron que la polimerasa del fago incorpora dZTP en el ADN, mientras elimina cualquier base A que se haya introducido. “Esto nos explicó por qué se excluyó A”, dice Kaminski. "Esto fue realmente espectacular".

Zhao cree que esta no es toda la historia. Su trabajo sugiere que se necesita otra enzima de fagos, una que rompa el dATP pero conserve el dZTP dentro de las células. Su equipo descubrió que aumentar los niveles de dZTP en relación con los de dATP era suficiente para engañar a la propia polimerasa de una célula para que produjera Z-DNA.


Diferencia entre la síntesis de proteínas y la replicación del ADN

Las proteínas y el ADN proporcionan el diseño más fundamental para mantener la vida en la Tierra. De hecho, las proteínas determinan la forma y las funciones de los organismos, mientras que el ADN conserva la información necesaria para ello. Por lo tanto, la síntesis de proteínas y la replicación del ADN podrían entenderse como procesos extremadamente importantes que tienen lugar en las células vivas.Ambos procesos comienzan a partir de la secuencia de nucleótidos de la cadena de ácido nucleico, pero son vías diferentes. Se explican los pasos importantes de ambos procesos y las diferencias entre ellos se analizan en este artículo.

Síntesis de proteínas

La síntesis de proteínas es un proceso biológico que tiene lugar dentro de las células de los organismos en tres pasos principales conocidos como transcripción, procesamiento de ARN y traducción. En el paso de transcripción, la secuencia de nucleótidos del gen en la cadena de ADN se transcribe en ARN. Este primer paso es muy similar a la replicación del ADN, excepto que el resultado es una cadena de ARN en la síntesis de proteínas. La hebra de ADN se desmantela con la enzima helicasa de ADN, la ARN polimerasa se une en el lugar específico del inicio del gen conocido como promotor y la cadena de ARN se sintetiza a lo largo del gen. Esta cadena de ARN recién formada se conoce como ARN mensajero (ARNm).

La cadena de ARNm lleva la secuencia de nucleótidos a los ribosomas para el procesamiento del ARN. Las moléculas específicas de ARNt (ARN de transferencia) reconocerán los aminoácidos relevantes en el citoplasma. Después de eso, las moléculas de ARNt se unen a los aminoácidos específicos. En cada molécula de ARNt, hay una secuencia de tres nucleótidos. Un ribosoma en el citoplasma se une a la cadena de ARNm y se identifica el codón de inicio (el promotor). Las moléculas de ARNt con los nucleótidos correspondientes para la secuencia de ARNm se mueven hacia la subunidad grande del ribosoma. A medida que las moléculas de ARNt llegan al ribosoma, el aminoácido correspondiente se une al siguiente aminoácido de la secuencia a través de un enlace peptídico. Este último paso se conoce como traducción de hecho, aquí es donde tiene lugar la síntesis de proteínas.

La forma de la proteína se determina a través de los diferentes tipos de aminoácidos de la cadena, que estaban unidos a las moléculas de ARNt, pero los ARNt son específicos de la secuencia de ARNm. Por lo tanto, está claro que las moléculas de proteína representan la información almacenada en la molécula de ADN. Sin embargo, la síntesis de proteínas también podría iniciarse a partir de una cadena de ARN.

Replicación de ADN

La replicación del ADN es el proceso de producir dos cadenas de ADN idénticas a partir de una e implica una serie de procesos. Todos estos procesos tienen lugar durante la fase S de la Interfase del ciclo celular o división celular. Es un proceso que consume energía y principalmente tres enzimas principales conocidas como ADN helicasa, ADN polimerasa y ADN ligasa están involucradas en la regulación de este proceso. Primero, la ADN helicasa desmantela la estructura de doble hélice de la hebra de ADN rompiendo los enlaces de hidrógeno entre las bases nitrogenadas de las hebras opuestas. Este desmantelamiento comienza desde un extremo de la cadena de ADN y no desde el medio. Por tanto, la ADN helicasa podría considerarse una exonucleasa de restricción.

Después de exponer las bases nitrogenadas del ADN monocatenario, los desoxirribonucleótidos correspondientes se ordenan de acuerdo con la secuencia de bases y los enlaces de hidrógeno respectivos se forman mediante la enzima ADN polimerasa. Este proceso en particular tiene lugar en ambas cadenas de ADN. Finalmente, los enlaces fosfodiéster se forman entre nucleótidos sucesivos, para completar la cadena de ADN utilizando la enzima ADN ligasa. Al final de todos estos pasos, se forman dos cadenas de ADN idénticas a partir de una sola cadena de ADN madre.

Diferencia entre la síntesis de proteínas y la replicación del ADN


DISCUSIÓN

Enzimas monoméricas de la superfamilia PLD como Tdp1 humana y PLD de Especies de Streptomyces (12, 13) son monómeros bilobulados (Figura 1A) que contienen en el sitio activo dos residuos de His de motivos de secuencia "HXK" duplicados localizados a distancia en la cadena de la proteína. Las histidinas del sitio activo de estas enzimas no son equivalentes y desempeñan funciones predefinidas en la catálisis. Un His en particular monta el ataque nucleofílico en el fosfato escindible para hacer un intermedio covalente (Figura 1B). No es sorprendente que su reemplazo por mutagénesis dirigida al sitio deje a la enzima completamente inactiva (13, 16, 26). El otro His juega un papel de apoyo: protona el grupo saliente durante la formación del intermedio covalente y posteriormente facilita la hidrólisis del enlace fosfohistidina. Las mutaciones del último residuo de histidina a menudo comprometen la actividad catalítica y dan como resultado la acumulación del intermedio covalente (27).

Las nucleasas de la familia PLD caracterizadas estructuralmente, Nuc y la endonucleasa de restricción BfiI (10, 14), son homodímeros que contienen un único sitio activo estructuralmente similar al de la Tdp1 humana y la PLD de Especies de Streptomyces. Sin embargo, a diferencia de las enzimas PLD monoméricas, el sitio activo de BfiI es completamente simétrico, ya que contiene dos residuos His relacionados por el eje de simetría doble del dímero, cada uno donado por una subunidad enzimática (Figura 1A). Esto excluye la asignación de los roles individuales de cada residuo de His en la catálisis. Para resolver este problema, interrumpimos la simetría doble intrínseca a BfiI mediante la construcción de formas heterodiméricas de la enzima (Figura 2).

Los roles de las histidinas de sitio activo en la catálisis

WT BfiI forma el intermedio covalente en sustratos de fosfodiéster truncado y 3'-fosforotiolato con velocidades comparables (2,1 y 7,7 s −1, respectivamente: Figura 3E), a pesar del grupo saliente sustancialmente más ácido del sustrato 3'-fosforotiolato [el pKa los valores de los grupos 3′-SH y 3′-OH son ∼11 y ∼16, respectivamente (28)], lo que sugiere que la protonación del grupo saliente 3′ no es un factor determinante de la velocidad para WT BfiI. La capacidad de BfiI para escindir el enlace 3'-fosforotiolato más rápidamente que el sustrato de oxígeno contrasta marcadamente con la mayoría de las nucleasas dependientes de metales (5, 29, 30). Estas enzimas, a diferencia de las BfiI independientes de metales, son inhibidas por la sustitución 3′-S debido a su interacción deficiente de los iones Mg 2+ con azufre; sin embargo, algunas de estas enzimas son rescatadas por el ion Mn 2+ más tiofílico (5, 29 ).

El reemplazo de una de las histidinas del sitio activo con alanina, en el heterodímero WT / H105A, resultó en una disminución dramática de 106 veces en la tasa de escisión del enlace oxiéster en el oligodúplex 14/15 (Figura 3E). La actividad residual podría deberse a una pequeña cantidad de WT BfiI presente en la muestra de heterodímero, pero diferentes preparaciones del heterodímero, incluidas las variantes alternativas WT (6His) / H105A y H105A (6His) / WT, dieron todos los mismos valores bajos. nivel de actividad. Por lo tanto, lo más probable es que la actividad observada sea intrínseca al heterodímero WT / H105A. Por tanto, el segundo residuo His105 en el sitio activo de BfiI acelera la formación del intermedio covalente en el sustrato fosfodiéster en un factor de al menos 106.

Sorprendentemente, el heterodímero escindió el enlace 3'-fosforotiolato en el dúplex 14 / 15s 10 5 veces más rápidamente que el grupo fosfodiéster en el sustrato 14/15 original (Figura 3E). La tasa resultante de formación de intermedio covalente por el heterodímero (0,19 s -1) es sólo 40 veces menor que la de la enzima WT en el mismo sustrato (7,7 s -1, Figura 3E). Además, la mejora de la tasa sobre el sustrato de oxígeno en un factor de 10 5 coincide con el pKa diferencia entre los grupos salientes 3′-OH y 3′-SH [∼5 unidades (28)]. Estas observaciones argumentan que uno de los dos residuos H105 en el homodímero WT de BfiI protona el grupo saliente 3 'durante el primer paso de reacción (Figura 1B): tras su eliminación, en el heterodímero WT / H105A, la estabilidad de la base conjugada del grupo saliente 3 'se convierte en un factor importante que gobierna la velocidad de reacción. La diferencia de velocidad entre las enzimas heterodiméricas y WT en el sustrato 3'-fosforotiolato implica que incluso el grupo saliente 3'-tio relativamente ácido debe protonarse para lograr la máxima velocidad de formación del intermedio covalente.

El segundo paso de la reacción, la hidrólisis de la enzima covalente-ADN intermedio (Figura 1B), es un proceso extremadamente rápido para WT BfiI (k2 = 170 s −1, Figura 3E). Sin embargo, la tasa se reduce en un factor de 17000 para el heterodímero WT / H105A (k2 = 0,010 s −1). El efecto dramático de la sustitución de H105A confirma la participación directa de la histidina del segundo sitio activo en la hidrólisis del intermedio de fosfohistidina covalente, presumiblemente, la segunda histidina activa la molécula de agua que hidroliza el intermedio mediante la eliminación de un protón (Figura 1B).

La sustitución única de H105A también invierte la relación de las velocidades de reacción para la formación (k1) y decadencia (k2) del intermedio covalente. Para WT BfiI en el sustrato 14 / 15s, la relación de k1/ k2 es 0,05, es decir, el intermedio covalente se forma 20 veces más lentamente de lo que se hidroliza. Para los heterodímeros WT (6His) / H105A y H105A / WT-N, la relación de k1/ k2 es ≥20, lo que conduce a la acumulación del intermedio covalente durante la reacción (Figuras 3C y 4A). El análisis bioquímico de las especies de baja movilidad postuladas como intermedias covalentes (datos suplementarios) indicó que este era el aducto de fosfohistidina esperado. El intermedio covalente está formado solo por el tipo salvaje pero no por la subunidad H105A del heterodímero (datos suplementarios). Además, como se esperaba para un compuesto de fosfohistidina (22, 24), el aducto BfiI-ADN es estable a pH alcalino pero se descompone en ácido (datos suplementarios).

Un mecanismo novedoso para la escisión del ADN bicatenario

Las nucleasas que cortan el ADN de doble hebra a menudo contienen dos subunidades idénticas relacionadas por simetría rotacional, de modo que el sitio activo de una subunidad escinde la hebra 5′-3 ′ mientras que el de la subunidad de orientación opuesta ataca al antiparalelo 3′-5 ′ Hilo (7). Sin embargo, esta estrategia no se puede generalizar para todas las nucleasas que actúan sobre el ADN bicatenario. Varias enzimas, incluida la endonucleasa autodirigida I-TevI ​​(31), el complejo RecBCD de E. coli (32) y la enzima de restricción BfiI (17) utilizan un solo sitio activo para cortar ambas cadenas de ADN, a pesar de sus polaridades opuestas.

La endonucleasa I-TevI ​​codificada por intrón es un monómero y contiene un único sitio activo, pero corta ambas cadenas de ADN en el sitio receptor para la localización del intrón, dejando en ambos casos productos con terminales 3′-hidroxilo y 5′-fosfato (33) . Se cree que primero escinde su enlace fosfodiéster objetivo en la hebra inferior y luego distorsiona el ADN para guiar hacia el sitio activo el fosfato escindible de la hebra superior (31). Sin embargo, todavía no está claro cómo su único sitio activo puede acomodar y cortar los enlaces fosfodiéster de las cadenas 3′-5 ′ y 5′-3 ′ del ADN, ya que en ambos casos tiene que desplazar el grupo saliente en el lado 3 ′ del fósforo en el enlace escindible: es decir, en direcciones opuestas en la cadena 3′-5 ′ en comparación con la cadena 5′-3 ′. Además, dada la estructura cristalina del dominio catalítico de I-TevI, no se pueden excluir esquemas de reacción alternativos, incluida la dimerización transitoria (34). El modo de acción de otra endonucleasa monomérica, FokI, implica la dimerización transitoria (35, 36), para dar un ensamblaje de proteínas en el sitio de reconocimiento con dos dominios catalíticos yuxtapuestos en alineación antiparalela (37, 38), cada uno de los cuales corta una hebra. del ADN. En este caso, el monómero 1 ° unido directamente al sitio de reconocimiento escinde la hebra inferior mientras que el monómero 2 ° reclutado en el sitio por interacciones proteína-proteína corta la hebra superior (25), pero la simetría dentro del dímero de los dominios catalíticos ( 37) permite que uno corte la hebra 3′-5 ′ y el otro la hebra 5′-3 ′.

los E. coli La enzima RecBCD actúa en la reparación de roturas de ADN de doble hebra como una proteína trimérica con múltiples actividades catalíticas que incluyen dos funciones de helicasa, ambas 3 ′ → 5 ′ y 5 ′ → 3 ′ en las subunidades B y D respectivamente y una función de endonucleasa simple , ubicado en B desde donde degrada ambas hebras (32). Para tener en cuenta cómo la nucleasa escinde ambas hebras recién desenrolladas a pesar de sus polaridades opuestas, se sugirió que el terminal 3 'naciente generado por RecB progresa directamente hacia el centro de la nucleasa, que también está en B, mientras que el extremo 5′- naciente El terminal generado por RecD forma un bucle antes de entrar en el centro de la nucleasa con la misma orientación 3′-5 ′ que la hebra 3′ (39). Sin embargo, este modelo aún no se ha confirmado experimentalmente, aunque puede conciliarse fácilmente con la estructura cristalina de RecBCD (40).

La enzima de restricción BfiI emplea otra estrategia más. Se había demostrado anteriormente que utiliza un único sitio activo para cortar ambas cadenas de ADN aguas abajo de su sitio de reconocimiento en pasos secuenciales, en un orden fijo, primero la cadena inferior y solo luego la cadena superior (17). La endonucleasa BfiI contiene dos residuos His colocados simétricamente en el sitio activo, por lo que se propuso que BfiI corta una hebra utilizando la histidina de una subunidad como nucleófilo y la de la otra subunidad como donante / aceptor de protones, mientras que estos roles se invierten para cortar la hebra complementaria de polaridad opuesta (17).

En este artículo, esta hipótesis se probó experimentalmente utilizando heterodímeros truncados de BfiI que carecen del dominio de unión al ADN de una subunidad: de la subunidad que lleva la mutación inactivante H105A, WT / H105A-N o de la subunidad WT, H105A / WT -NORTE. A diferencia de los heterodímeros de longitud completa que llevan ambos dominios de reconocimiento de ADN (Figura 3D), cada heterodímero truncado tiene que unirse al ADN en una orientación específica: ya sea la orientación productiva en la que el residuo His105 de la subunidad WT está posicionado para el ataque en línea en el fosfato escindible o la orientación no productiva donde el residuo en posición para el ataque en línea es la alanina de la subunidad H105A (Figura 4A y B). Por tanto, si el heterodímero WT / H105-N muestra actividad catalítica, el intermedio covalente está formado por la histidina a partir de la subunidad enzimática de longitud completa unida al sitio diana en el ADN, la subunidad 1 °. Alternativamente, si la variante H105A / WT-N muestra actividad, el nucleófilo de histidina proviene de la subunidad truncada que no está unida a la secuencia de reconocimiento, la subunidad 2 °. Así, al analizar las actividades de los heterodímeros truncados, pudimos identificar directamente qué residuo de histidina forma el intermedio covalente durante la escisión de las cadenas de ADN inferior (3′-5 ′) y superior (5′-3 ′).

Contrariamente a la sugerencia de que el H105 de una subunidad particular de BfiI ataca el enlace escindible en la cadena de ADN inferior (3′-5 ′), mientras que el H105 relacionado con la simetría de la subunidad opuesta toma este papel para cortar la parte superior (5′-3 ′), Se encontró aquí que el His de la subunidad 2 ° no unido al sitio de reconocimiento ataca secuencialmente los enlaces fosfodiéster diana en las cadenas 3′-5 ′ y 5′-3 ′. La histidina equivalente de la subunidad 1 ° unida al ADN actúa presumiblemente como donante / aceptor de protones para las reacciones en ambas cadenas. Para que coincida con la polaridad antiparalela de las dos hebras de ADN, el centro catalítico de BfiI, por lo tanto, debe girar 180 ° entre las dos reacciones de hidrólisis (Figura 4C). Por lo tanto, demostramos aquí un mecanismo novedoso para la escisión del ADN de doble hebra, ya que requiere un único sitio activo no solo para cambiar entre hebras, sino también para cambiar su orientación en el ADN.

Todas las reacciones anteriores contenían BfiI en exceso sobre el ADN, para favorecer la unión de una única molécula de ADN a cada dímero enzimático. Sin embargo, BfiI es óptimamente activo cuando se une a dos copias de su secuencia de reconocimiento (18). Para cortar cuatro enlaces fosfodiéster en dos sitios diana, el sitio activo único en el dímero BfiI debe reubicarse entre los fosfatos escindibles en los dos sitios, escindiendo un enlace fosfodiéster a la vez. En el complejo sináptico del dímero BfiI con dos sitios de reconocimiento (Figura 4D), una subunidad (B) se une a través de su dominio de unión al ADN al sitio de reconocimiento X mientras que la otra subunidad (A) se une al sitio Y. Esto deja la subunidad A como la subunidad 2 ° con respecto al sitio de reconocimiento X, por lo que H105 de A presumiblemente forma el intermedio covalente durante el corte secuencial de ambas hebras en el sitio X, mientras que H105 de la subunidad B cumple las funciones de donante / aceptor de protones en ambos eventos de escisión de hebra . Por el contrario, la subunidad B es la subunidad 2 ° para el sitio Y, por lo que, para cortar este segundo sitio, los residuos H105 de las subunidades B y A deben cumplir las mismas funciones que desempeñan, respectivamente, las subunidades A y B al cortar sitio X. Por lo tanto, los dos residuos de His pueden cambiar de función mientras escinden dos sitios específicos unidos a un dímero enzimático (Figura 4D), aunque siempre será la histidina de una subunidad particular la que ataque tanto las hebras inferiores como las superiores en cada sitio de ADN ( Figura 4C).