Información

¿Existen variaciones anuales en la disponibilidad de HIOMT (HydroxyIndole-O-MethylTransferase)?

¿Existen variaciones anuales en la disponibilidad de HIOMT (HydroxyIndole-O-MethylTransferase)?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy leyendo un folleto sobre la melatonina publicado en 1996, titulado "Melatonina y el reloj biológico". Y vea la siguiente declaración:

HIOMT (HydroxyIndole-O-MethylTransferase), una de las enzimas de la síntesis de melatonina, sube y baja en un ritmo anual, con mínimos en marzo y octubre y picos en enero y julio.

Al ver cómo HIOMT es la última metiltransferasa involucrada en la síntesis de melatonina en humanos, Estoy interesado en saber si de hecho existe una variación anual en esta producción de MT en humanos, y si está regulada por la genética o la duración del fotoperíodo.

¡Gracias por su aporte!


Esta no es realmente una respuesta completa, pero no puedo incluirla en un comentario.

Descubrí que existe una gran cantidad de literatura sobre la estacionalidad de los niveles de melatonina en varios vertebrados, particularmente el ganado, debido a su interacción con los patrones de reproducción. Sin embargo, es difícil encontrar estudios similares en humanos, pero el artículo de revisión citado a continuación analiza un vínculo entre las variaciones estacionales en los niveles de melatonina y las variaciones estacionales en las funciones del sistema inmunológico. Cita algunas referencias que valdría la pena seguir.

Srinivasan, V. et al. (2008) Inmunomodulación por melatonina: su importancia para las enfermedades estacionales. Neuroinmunomodulación 15: 93-101 DOI: 10.1159 / 000148191

Abstracto La melatonina no solo es sintetizada por la glándula pineal sino también en muchos otros órganos y tejidos del cuerpo, particularmente por órganos linfoides como la médula ósea, el timo y los linfocitos. La melatonina participa en diversas funciones del organismo, entre las cuales su función inmunomoduladora ha adquirido una importancia considerable en los últimos años. Se ha demostrado que la melatonina participa en la regulación de la inmunidad tanto celular como humoral. La melatonina no solo estimula la producción de células asesinas naturales, monocitos y leucocitos, sino que también altera el equilibrio de las células T helper (Th) -1 y Th-2 principalmente hacia las respuestas Th-1 y aumenta la producción de citocinas relevantes como interleucina (IL) -2, IL-6, IL-12 e interferón-γ. La función reguladora de la melatonina sobre los mecanismos inmunitarios depende de la estación. Este hecho puede explicar en parte el patrón cíclico de expresión de los síntomas que muestran ciertas enfermedades infecciosas, que se vuelven más pronunciadas en determinadas épocas del año. Además, los cambios estacionales inducidos por la melatonina en la función inmunitaria también se han implicado en la patogénesis del trastorno afectivo estacional y la artritis reumatoide. En esta revisión se analiza la importancia clínica del papel inmunomodulador de la melatonina que cambia estacionalmente.


Desarrollo de la actividad hidroxiindol ‐ O ‐ metiltransferasa en la retina del embrión de pollo y el pollito

Seleccionar datos cortesía de la Biblioteca Nacional de Medicina de EE. UU. & copy 2021 DeepDyve, Inc. Todos los derechos reservados.

Comparta el texto completo de este artículo con hasta 5 colegas GRATIS

¡Regístrese para su prueba gratuita de 14 días ahora!

Lea e imprima miles de las principales revistas académicas.

Guardar artículo en marcadores

Marque este artículo como favorito. Puede ver sus marcadores en su biblioteca de DeepDyve.

Para guardar un artículo, iniciar sesión primero, o inscribirse para una cuenta de DeepDyve si aún no tiene una.

Suscríbase a las alertas por correo electrónico del diario

Para suscribirse a las alertas por correo electrónico, iniciar sesión primero, o inscribirse para una cuenta de DeepDyve si no tiene ya una.

Copie y pegue el formato de cita deseado o use el enlace a continuación para descargar un archivo formateado para EndNote

Gerentes de referencia

Seguir un diario

Para obtener actualizaciones de nuevos artículos de una revista en su página de inicio personalizada, por favor iniciar sesión primero, o inscribirse para una cuenta de DeepDyve si no tiene ya una.

Nuestra política sobre el uso de cookies

Todos los sitios web de DeepDyve utilizan cookies para mejorar su experiencia en línea. Se colocaron en su computadora cuando lanzó este sitio web. Puede cambiar la configuración de las cookies a través de su navegador.


Contenido

N-acetilserotonina O-metiltransferasa es una enzima codificada por genes ubicados en la región pseudoautosomal del cromosoma X e Y, y se encuentra con mayor abundancia en la glándula pineal y la retina de los seres humanos. & # 914 & # 93 Aunque la estructura exacta de N- acetilserotonina O-metiltransferasa aún no ha sido determinada por difracción de rayos X, la estructura cristalina del dominio Maf de humanos N-acetilserotonina O-metiltransferasa-se ha encontrado una proteína similar. & # 915 & # 93


Introducción

Los tumores del parénquima pineal (PPT), derivados de los pineocitos, son neoplasias raras y representan menos del 1% de los tumores primarios del sistema nervioso central (SNC) (1). La clasificación revisada de la Organización Mundial de la Salud de los tumores del SNC divide los PPT en pineocitoma (PC), pineoblastoma (PB) y PPT de diferenciación intermedia (PPTID) (2). Las tasas de supervivencia a 5 años de CP, PPTID y PB son del 86% al 100%, del 39% al 74% y del 58%, respectivamente (2). Histológicamente, un índice mitótico alto y necrosis se asocian con un peor resultado, mientras que la inmunotinción positiva para neurofilamentos se asocia con una mejor supervivencia (1). La distinción de los PPT de alto grado de otros tumores embrionarios en el SNC se ha basado en gran medida en el conocimiento del sitio primario del tumor y el grado de diferenciación pineocitomatosa, como procesos argirofílicos en forma de maza, rosetas pineocitomatosas y fotorreceptores (2). Los PPT muestran inmunotinción positiva para la proteína S100, enolasa específica de neuronas, sinaptofisina, neurofilamentos, β-tubulina clase III, proteína tau, PGP9.5, antígeno S retiniano (SAG), cromogranina A, serotonina y cristalina α-B ( 1, 3-8). Estas proteínas son útiles para la identificación de células neurales y de la cresta neural. Sin embargo, no existe un marcador específico disponible para diferenciar los PPT de alto grado de otros tumores embrionarios (2).

La melatonina es una poderosa molécula antioxidante involucrada en la protección del ADN nuclear y mitocondrial y en la regulación de los ritmos estacionales circadianos y la función inmunológica (9-13). Es producido y secretado predominantemente por la glándula pineal. El triptófano, el precursor de la melatonina, se metaboliza en 5-hidroxitriptófano por triptófano-hidroxilasa El 5-hidroxitriptófano es luego metabolizado por el aminoácido aromático descarboxilasa en norte-acetilserotonina. norte-acetilserotonina luego se somete a modificación por arilalquilamina-norte-acetiltransferasa. El resultado de esta modificación es metabolizado en melatonina por hidroxiindol.O-metiltransferasa (HIOMT) (14).

La expresión de ARN mensajero (ARNm) para triptófano-hidroxilasa, arilalquilamina-norte-acetiltransferasa y HIOMT se han detectado previamente en tejidos o cultivos celulares derivados de PPT mediante micromatrices, transcripción inversa en tiempo real y reacción en cadena de la polimerasa, hibridación in situ y análisis de transferencia Northern (15-17). Además, se ha detectado actividad HIOMT en PPT (18-20). La evidencia de una alta expresión de ARNm en PPT para estas enzimas sugiere que uno o más de ellos podrían servir como marcadores de diagnóstico y herramientas para comprender la biología de los PPT. En el presente estudio, nos centramos en HIOMT y analizamos las glándulas pineales normales, otros tejidos humanos, PPT y tumores embrionarios en el SNC mediante inmunohistoquímica (IHC) en busca de evidencia de síntesis de melatonina. Además, correlacionamos la expresión de HIOMT con la diferenciación histológica de los PPT. También comparamos la expresión de HIOMT con la de SAG retiniano, una proteína fotorreceptora soluble principal que participa en la desensibilización de la cascada de transducción fotoactivada (21-23), en PPT del SNC y tumores embrionarios.


Materiales y métodos

Modelo animal

Utilizamos un modelo establecido de manipulación global de nutrientes maternos [13, 14, 42] para inducir la restricción del crecimiento fetal. Brevemente, las ratas Wistar hembras (de 120 días de edad) se aparearon en el tiempo y, después de la confirmación del apareamiento, las ratas se alojaron individualmente en jaulas para ratas estándar con acceso libre al agua. Todas las ratas se mantuvieron en la misma habitación con una temperatura constante mantenida a 25 ° C y un ciclo de 12L: 12D. Las madres embarazadas se asignaron al azar en uno de cuatro grupos: 1) madres alimentadas con una dieta de control de 18% de proteína, 5% de grasa y 3,4 kcal / g de energía digestible (Dieta 2018 Harlan Teklad) ad libitum durante el embarazo y la lactancia (Cont n = 8 ) 2) presas desnutridas alimentadas con 50% de la ingesta de Cont durante el embarazo y la lactancia (UNPL, n = 7) 3) presas desnutridas alimentadas con el 50% de la ingesta de Cont solo durante el embarazo (UNP, n = 6) y 4) presas desnutridas alimentadas al 50% de la ingesta de Cont durante la lactancia solamente (UNL, n = 6). Después del nacimiento, las crías se sexaron, pesaron y el tamaño de la camada se estandarizó a ocho crías que representaban mejor (estaban más cerca) del peso medio de la camada. Cada camada contenía cuatro hembras y cuatro machos. Al destete (día 22), se pesó a las crías y se comparó el peso de las crías hembras dentro de los grupos dietéticos maternos, se alojaron dos por jaula y se alimentaron con la dieta de control ad libitum durante el resto del estudio. A los 150 días de edad, las crías (de diferentes camadas) se dejaron en ayunas durante la noche y se sacrificaron por decapitación después de la anestesia con pentobarbitona (60 mg / kg, por vía subcutánea). Todo el tejido ovárico se recogió entre las 0900 y las 1200. Mientras se encontraba bajo anestesia, se realizaron frotis vaginales para determinar el estado estral [13-15]. Se recolectaron ambos ovarios, uno se fijó en solución de Bouin (Sigma-Aldrich) y se procesó para la determinación de recuentos foliculares [13] o para inmunohistoquímica y el otro se congeló instantáneamente y se almacenó a -80 ° C para análisis moleculares. En todos los casos, todas las réplicas biológicas son de diferentes camadas. Todos los experimentos con animales fueron aprobados por el Comité de Ética Animal de la Universidad de Auckland (Aprobación R402).

Análisis moleculares

Extracción de ARN y transcripción inversa.

Los tejidos ováricos se recogieron, se congelaron rápidamente y se almacenaron a -80 ° C en preparación para la extracción de ARN y se transcribieron de forma inversa como se describió anteriormente [13, 43, 44]. El ARN total se extrajo usando el kit AllPrep DNA / RNA Mini (80204 Qiagen). El ADN genómico se eliminó con ADNasa sin ARNasa (Invitrogen Life Technologies). La cantidad y la pureza del ARN se analizaron usando un espectrofotómetro NanoDrop (ND-1000 BioLab Ltd.) y el software NanoDrop (versión 3.1.2). Las muestras de ARN se almacenaron a -80 ° C.

Se utilizaron cinco microgramos de ARN total para la síntesis de ADNc de primera hebra utilizando la enzima transcriptasa inversa del virus de la leucemia murina de Moloney (M-MLV-RT) (Promega Corp.) y un termociclador estándar (GeneAmpH PCR System 9700 Applied Biosystems). Se preparó una mezcla maestra que contenía 5 ml de tampón M-MLV 56 (M531A In Vitro Technologies), 0,5 ml de M-MLV-RT (M170B In Vitro Technologies) y 1,25 ml de desoxirribonucleótidos 10 mM (R0181 Global Science) en las siguientes condiciones de ciclo : etapa de desnaturalización de 5 min a 96 ° C, seguida de 30 ciclos de 30 segundos cada uno de 96 ° C (desnaturalización), 60 ° C (etapa de recocido) y 72 ° C (etapa de extensión). El ADN complementario se almacenó a -20 ° C.

Ensayos cuantitativos de reacción en cadena de la polimerasa.

Se realizó un ensayo de PCR cuantitativa como se describió anteriormente [13] utilizando el sistema Roche LightCycler 480 (Roche Diagnostics) y LightCycler 480 SYBR Green I Master (04707516001 Roche Diagnostics). Cebadores para todos los genes de estrés, autofagia, inflamación, receptor de gonadotropina y genes del reloj del ER, excepto Period e hidroxiindol O-metiltransferasa (HIOMT): se diseñaron utilizando el software Primer BLAST disponible en el sitio web del Centro Nacional de Información Biotecnológica (blast.ncbi.nlm.nih.gov Tabla 1). Los cebadores fueron fabricados por Invitrogen (Invitrogen Life Technologies). Se adquirieron de Qiagen cebadores listos para usar para los genes Period (per1, per2) y HIOMT (Tabla 2).

Gen de rata a. Imprimación delantera. Imprimación inversa. Longitud del amplicón (pb). No de acceso de GenBank. .
Beta-actinaCACCAACTGGGACGATATGGA CAGCCTGGATGGCTACGTACAT 188 NM_031144
CiclofilinaTTGGGTCGCGTCTGCTTCGA GCCAGGACCTGTATGCTTCA 240 NM_017101.1
BMAL1ACTGCACCTCGGGAGCGACT CGCCCGATTGCAACGAGGCA 320 NM_024352.2
RELOJACCGCACCTGCCAGCTCATG GCGTGTCCGCTGCTCTAGCT 214 NM_021856.1
CRY1CGGAAGCTCGTGTCGGTCCG CGCGCGACGTCCTTCAGGAG 232 NM_198750.2
CRY2ACGGTCCCCGTGCAGTCGAT CTGACGAGGAGGCCGCGAAC 166 NM_113405
p21AGCCACAGGCACCATGTCCGA CGCATCGCAATCGCGGCTCA 118 U24174.1
XBP1sGAGTCCGCAGCAGGTG GCGTCAGAATCCATGGGA 165 NM_001004210
XBP1tGAGCAGCAAGTGGTGGATTT TCTCAATCACAAGCCCATGA 197 NM_001004210
P13Kca (p110) GAACGTGTGCCGTTTGTTTT ACCATGATGTGCGTCATTCA 300 NM_133399.2
P1K3r1 (p85) AGCAACCGAAACAAAGCCGA ATAGCCGGTGGCAGTCTTGT 153 NM_013005.1
Gen de rata a. Imprimación delantera. Imprimación inversa. Longitud del amplicón (pb). No de acceso a GenBank. .
Beta-actinaCACCAACTGGGACGATATGGA CAGCCTGGATGGCTACGTACAT 188 NM_031144
CiclofilinaTTGGGTCGCGTCTGCTTCGA GCCAGGACCTGTATGCTTCA 240 NM_017101.1
BMAL1ACTGCACCTCGGGAGCGACT CGCCCGATTGCAACGAGGCA 320 NM_024352.2
RELOJACCGCACCTGCCAGCTCATG GCGTGTCCGCTGCTCTAGCT 214 NM_021856.1
CRY1CGGAAGCTCGTGTCGGTCCG CGCGCGACGTCCTTCAGGAG 232 NM_198750.2
CRY2ACGGTCCCCGTGCAGTCGAT CTGACGAGGAGGCCGCGAAC 166 NM_113405
p21AGCCACAGGCACCATGTCCGA CGCATCGCAATCGCGGCTCA 118 U24174.1
XBP1sGAGTCCGCAGCAGGTG GCGTCAGAATCCATGGGA 165 NM_001004210
XBP1tGAGCAGCAAGTGGTGGATTT TCTCAATCACAAGCCCATGA 197 NM_001004210
P13Kca (p110) GAACGTGTGCCGTTTGTTTT ACCATGATGTGCGTCATTCA 300 NM_133399.2
P1K3r1 (p85) AGCAACCGAAACAAAGCCGA ATAGCCGGTGGCAGTCTTGT 153 NM_013005.1

BMAL1, proteína similar a Arnt cerebral y muscular 1 RELOJ, ciclos de producción locomotora circadiana kaput P13Kca (p110), fosfatidilinositol-4,5-bisfosfato 3-quinasa, subunidad catalítica alfa CRY1 y CRY2, criptocromo 1 y 2, respectivamente P1K3r1 (p85), subunidad reguladora de fosfatidilinositol 3-quinasa 1 (alfa) p21, Inhibidor de quinasa dependiente de ciclina 1 (también conocido como proteína 1 que interactúa con CDK) XBP1s y XBP1t, Proteína 1 de unión a caja X empalmada y total, respectivamente.

Gen de rata a. Imprimación delantera. Imprimación inversa. Longitud del amplicón (pb). No de acceso a GenBank. .
Beta-actinaCACCAACTGGGACGATATGGA CAGCCTGGATGGCTACGTACAT 188 NM_031144
CiclofilinaTTGGGTCGCGTCTGCTTCGA GCCAGGACCTGTATGCTTCA 240 NM_017101.1
BMAL1ACTGCACCTCGGGAGCGACT CGCCCGATTGCAACGAGGCA 320 NM_024352.2
RELOJACCGCACCTGCCAGCTCATG GCGTGTCCGCTGCTCTAGCT 214 NM_021856.1
CRY1CGGAAGCTCGTGTCGGTCCG CGCGCGACGTCCTTCAGGAG 232 NM_198750.2
CRY2ACGGTCCCCGTGCAGTCGAT CTGACGAGGAGGCCGCGAAC 166 NM_113405
p21AGCCACAGGCACCATGTCCGA CGCATCGCAATCGCGGCTCA 118 U24174.1
XBP1sGAGTCCGCAGCAGGTG GCGTCAGAATCCATGGGA 165 NM_001004210
XBP1tGAGCAGCAAGTGGTGGATTT TCTCAATCACAAGCCCATGA 197 NM_001004210
P13Kca (p110) GAACGTGTGCCGTTTGTTTT ACCATGATGTGCGTCATTCA 300 NM_133399.2
P1K3r1 (p85) AGCAACCGAAACAAAGCCGA ATAGCCGGTGGCAGTCTTGT 153 NM_013005.1
Gen de rata a. Imprimación delantera. Imprimación inversa. Longitud del amplicón (pb). No de acceso de GenBank. .
Beta-actinaCACCAACTGGGACGATATGGA CAGCCTGGATGGCTACGTACAT 188 NM_031144
CiclofilinaTTGGGTCGCGTCTGCTTCGA GCCAGGACCTGTATGCTTCA 240 NM_017101.1
BMAL1ACTGCACCTCGGGAGCGACT CGCCCGATTGCAACGAGGCA 320 NM_024352.2
RELOJACCGCACCTGCCAGCTCATG GCGTGTCCGCTGCTCTAGCT 214 NM_021856.1
CRY1CGGAAGCTCGTGTCGGTCCG CGCGCGACGTCCTTCAGGAG 232 NM_198750.2
CRY2ACGGTCCCCGTGCAGTCGAT CTGACGAGGAGGCCGCGAAC 166 NM_113405
p21AGCCACAGGCACCATGTCCGA CGCATCGCAATCGCGGCTCA 118 U24174.1
XBP1sGAGTCCGCAGCAGGTG GCGTCAGAATCCATGGGA 165 NM_001004210
XBP1tGAGCAGCAAGTGGTGGATTT TCTCAATCACAAGCCCATGA 197 NM_001004210
P13Kca (p110) GAACGTGTGCCGTTTGTTTT ACCATGATGTGCGTCATTCA 300 NM_133399.2
P1K3r1 (p85) AGCAACCGAAACAAAGCCGA ATAGCCGGTGGCAGTCTTGT 153 NM_013005.1

BMAL1, proteína similar a Arnt cerebral y muscular 1 RELOJ, ciclos de producción locomotora circadiana kaput P13Kca (p110), fosfatidilinositol-4,5-bisfosfato 3-quinasa, subunidad catalítica alfa CRY1 y CRY2, criptocromo 1 y 2, respectivamente P1K3r1 (p85), subunidad reguladora de fosfatidilinositol 3-quinasa 1 (alfa) p21, Inhibidor de quinasa dependiente de ciclina 1 (también conocido como proteína 1 que interactúa con CDK) XBP1s y XBP1t, Proteína de unión a X-box 1 empalmada y total, respectivamente.

Ensayos de cebadores Qiagen QuantiTect.

Gen de rata a. Número de catalogo . Número de acceso a GenBank.
PER1QT01615726 NM_001034125
PER2QT00184737 NM_031678
HIOMTQT02336901 NM_144759
Beclin1QT00176344 NM_001034117
NFκBQT01580012 NM_199267
MAP1LC3aQT00371546 NM_199500
IL-6QT00182896 NM_012589
IL-1βQT00181657 NM_031512
Gen de rata a. Número de catalogo . Número de acceso a GenBank.
PER1QT01615726 NM_001034125
PER2QT00184737 NM_031678
HIOMTQT02336901 NM_144759
Beclin1QT00176344 NM_001034117
NFκBQT01580012 NM_199267
MAP1LC3aQT00371546 NM_199500
IL-6QT00182896 NM_012589
IL-1βQT00181657 NM_031512

PER1 y PER2, Genes del período 1 y 2, respectivamente NFκB, factor nuclear potenciador de cadena ligera kappa de células B activadas IL-6, interleucina 6 IL-1β, interleucina 1-beta MAP1LC3a, proteína asociada a microtúbulos 1 cadena ligera 3 alfa HIOMT, hidroxiindol O-metiltransferasa.

Ensayos de cebadores Qiagen QuantiTect.

Gen de rata a. Número de catalogo . Número de acceso a GenBank.
PER1QT01615726 NM_001034125
PER2QT00184737 NM_031678
HIOMTQT02336901 NM_144759
Beclin1QT00176344 NM_001034117
NFκBQT01580012 NM_199267
MAP1LC3aQT00371546 NM_199500
IL-6QT00182896 NM_012589
IL-1βQT00181657 NM_031512
Gen de rata a. Número de catalogo . Número de acceso a GenBank.
PER1QT01615726 NM_001034125
PER2QT00184737 NM_031678
HIOMTQT02336901 NM_144759
Beclin1QT00176344 NM_001034117
NFκBQT01580012 NM_199267
MAP1LC3aQT00371546 NM_199500
IL-6QT00182896 NM_012589
IL-1βQT00181657 NM_031512

PER1 y PER2, Genes del período 1 y 2, respectivamente NFκB, factor nuclear potenciador de cadena ligera kappa de células B activadas IL-6, interleucina 6 IL-1β, interleucina 1-beta MAP1LC3a, proteína asociada a microtúbulos 1 cadena ligera 3 alfa HIOMT, hidroxiindol O-metiltransferasa.

Las condiciones óptimas del cebador se ajustaron a las siguientes condiciones de ciclo: longitud = 20 pb (rango 17-23 pb), Tm = 63 ° C (rango 60 ° C-65 ° C) y longitud del amplicón = 100-350 pb.Se realizaron análisis de disociación para asegurar la especificidad y se utilizaron muestras que producían un solo pico en las curvas de disociación. Se visualizó un subconjunto de productos amplificados en un gel de agarosa usando el gel E-GelH CloneWell 0.8% SYBR Safe (G6618-08 Invitrogen) ejecutado en el E-GelH iBaseTM Power System (G6400 Invitrogen).

Todas las PCR cuantitativas se llevaron a cabo con una desnaturalización inicial a 95 ° C durante 5 min seguida de la amplificación del producto génico a través de 45 ciclos sucesivos de 95 ° C durante 10 segundos, 60 ° C durante 10 segundos y 72 ° C durante 10 segundos. segundo. Se generó una curva estándar a partir del umbral de ciclo medio de ocho estándares (dilución en serie 1: 5) de una concentración conocida por triplicado, mientras que se generaron curvas de amplificación y disociación para todos los estándares y muestras (Roche Lightcycler 480 System Roche Diagnostics). Cada muestra se analizó por triplicado. Todos los datos de ARNm se expresan en relación con la media geométrica de dos genes de referencia diferentes (ciclofilina y beta-actina), cuyos niveles no difieren entre los grupos nutricionales.

Inmunohistoquímica e inmunofluorescencia

Los ovarios fijos se procesaron para microscopía, se incrustaron en parafina y el ovario completo se seccionó en serie a 8 μm como se describió anteriormente [13]. Las secciones que no se utilizaron para el recuento de folículos se utilizaron luego para inmunohistoquímica / inmunofluorescencia.

Determinación de la apoptosis folicular

La detección de células apoptóticas en los folículos se realizó como se describió anteriormente [33]. Se usó un kit de marcaje de extremos de mella de trifosfato de desoxiuridina trifosfato mediado por desoxinucleotiditransferasa terminal (TUNEL) (Roche Applied Science) de acuerdo con el protocolo del fabricante. En resumen, se permeabilizaron secciones de tejido ovárico (8 μm) en Triton X-100 (Sigma) al 0,1%, se lavaron en PBS y se incubaron durante 60 min con la enzima TUNEL conjugada con isotiocianato de fluoresceína para detectar la fragmentación del ADN. Los núcleos se contratiñeron con yoduro de propidio. Las células apoptóticas que mostraban tinción positiva para TUNEL se contaron en seis campos de visión por sección a 250 aumentos (n = 5 por grupo nutricional). El análisis de imágenes se realizó utilizando un microscopio Olympus BX-61 y un software de morfometría integrado (MetaMorph). Los datos se expresan como células foliculares apoptóticas positivas como proporción del total.

Determinación de la densidad de los vasos sanguíneos ováricos e inmunolocalización de VEGF y VEGFR2

La evaluación de la densidad de los vasos sanguíneos se realizó como se describió anteriormente utilizando el marcador de células endoteliales, CD31 [45]. Brevemente, se sumergieron secciones de ovario (8 µm) en peróxido de hidrógeno al 30% para inhibir la actividad de peroxidasa endógena durante 10 min. La recuperación del antígeno se realizó incubando tejidos en tampón de citrato de sodio 10 mM con Tween, pH 6,0, a 90ºC durante 12 min. La unión inespecífica se bloqueó con albúmina de suero bovino al 5% durante 10 min a temperatura ambiente (RT) y se incubó durante la noche a 4ºC con anticuerpo primario anti-CD31 (dilución de Abcam 1: 100). Al día siguiente, las secciones de tejido se incubaron a TA durante 2 h con anticuerpo secundario biotinilado anti-ratón (Sigma-Aldrich Canada Ltd.) y luego se incubaron con ExtrAvidin (Sigma-Aldrich Canada Ltd.) durante 1 h. Se visualizó CD31 con 3,3'-diaminobencidina (DAB) (D4293 Sigma-Aldrich), y todas las secciones se contratiñeron con hematoxilina Gills 2 (GHS216 Sigma-Aldrich). Para la determinación de la densidad de los vasos sanguíneos, se midieron vasos sanguíneos inmunopositivos para CD31 (células endoteliales) en seis campos de visión por sección a 250 aumentos (n = 5 por grupo nutricional). El análisis de imágenes se realizó utilizando un microscopio Olympus BX-61 y un software de morfometría integrado (MetaMorph). Los datos se expresan como área del vaso como proporción del área total de ovarios analizada.

La localización de proteínas del factor de crecimiento endotelial vascular (VEGF), su receptor tipo 2 (VEGFR2) y su colocalización se realizó mediante inmunofluorescencia en secciones de ovario (8 μm). Las secciones se incubaron durante 1 h con VEGF antihumano policlonal de conejo (dilución 1: 600 de Santa Cruz Biotechnology), se lavaron con PBS y se incubaron durante 1 h con una inmunoglobulina G anticonejo conjugada con Alexa Fluor 488 (cadenas pesadas y ligeras de IgG). ), F (ab ′)2 fragmento (dilución 1: 250, señalización celular 8889). A continuación, las secciones se lavaron dos veces durante 2 min con 1 x PBS y se incubaron con VEGFR2 antihumano policlonal de conejo (dilución 1: 500 de Santa Cruz Biotechnology). Después de una incubación de 1 hora, las secciones de tejido se lavaron con PBS y se incubaron durante otra hora con IgG anti-conejo conjugado con Alexa Fluor 594 (cadenas pesadas y ligeras), fragmento F (ab '). Los núcleos se contratiñeron con yoduro de propidio o 4 ', 6-diamino-2-fenilindol, y las muestras se obtuvieron con un microscopio fluorescente BX-61 (Olympus). Los portaobjetos teñidos se almacenaron a 4 ° C. La inmunotinción total de VEGF y VEGFR2 se cuantificó determinando la proporción de células inmunopositivas en seis campos de visión por sección a 250 aumentos (n = 5 por grupo nutricional). El análisis de imágenes se realizó utilizando un microscopio Olympus BX-61 y un software de morfometría integrado (MetaMorph). Los datos se expresan como células positivas para VEGF / VEGFR2 como proporción del área total de ovario analizada. También se calculó la cantidad de área donde se colocalizaban VEGF y VEGFR2 y se expresó como una proporción del área total analizada. Todos los análisis de imágenes fueron realizados por un investigador ciego a los grupos de estudio.

Inmunolocalización del regulador de autofagia, Beclin1

La inmunolocalización de Beclin1 en secciones de tejido ovárico se realizó como se describió anteriormente con las siguientes modificaciones. Las secciones de ovario se incubaron con anticuerpo Beclin1 (dilución 1: 300, ab55878 Cedarlane) durante la noche a 4ºC. Al día siguiente, las secciones se incubaron con anticuerpo secundario biotinilado (dilución 1:10, Vectastain Elite ABC kit peroxidasa conejo IgG Vector Labs) durante 2 horas a temperatura ambiente y luego se incubaron con solución de complejo de avidina-biotina peroxidasa (dilución 4:10 usando 1% de bovino albúmina sérica en 1 × PBS) durante 2 ha TA. El complejo de anticuerpos se visualizó usando DAB, y las secciones se contratiñeron con hematoxilina Gills II. Se montaron cubreobjetos utilizando Permount (SP15-500 Fisher Scientific) y se obtuvieron imágenes de células inmunopositivas utilizando el programa de formación de imágenes NIS-Elements AR en un microscopio Nikon 90i a 200 aumentos. La inmunotinción total de Beclin1 se cuantificó determinando la densidad media de células inmunopositivas marrones (sustrato DAB) en seis campos de visión por sección a 200 aumentos (n = 5 por grupo nutricional) utilizando el programa de imágenes NIS-Elements AR (Nikon). En todos los ensayos inmunohistoquímicos, los controles negativos se incubaron en ausencia del anticuerpo primario y se incluyeron en cada ejecución del ensayo. Todos los análisis de imágenes fueron realizados por un investigador cegado a los grupos de estudio.

Análisis estadístico

Todos los datos se analizaron mediante ANOVA de una vía. Los datos que no se distribuyeron normalmente se transformaron logarítmicamente para lograr la normalidad. Se realizaron comparaciones múltiples post-ANOVA entre las medias utilizando el análisis post hoc de Bonferroni cuando fue apropiado, y PAG & lt 0,05 se consideró estadísticamente significativo. Todos los datos se presentan como medias ± SEM. El análisis estadístico se realizó utilizando SigmaStat para Windows versión 2.03 (Jandel Corp.) y GraphPad Prism versión 6.00 para Mac (GraphPad Software).


& ltp> Esta sección describe las modificaciones postraduccionales (PTM) y / o eventos de procesamiento. & ltp> & lta href = '/ help / ptm_processing_section' target = '_ top'> Más. & lt / a> & lt / p> PTM / Procesamiento i

Procesamiento de moléculas

Tecla de funciónPuesto (s)Descripción Acciones Vista graficaLargo
& ltp> Esta subsección de la sección 'PTM / Procesamiento' describe la extensión de una cadena polipeptídica en la proteína madura después del procesamiento o escisión proteolítica. & ltp> & lta href = '/ help / chain' target = '_ top'> Más. & lt / a> & lt / p> Cadena i PRO_0000083982 1 – 345 Acetilserotonina O-metiltransferasa Agregar BLAST 345

Bases de datos proteómicas

MassIVE - Entorno virtual interactivo de espectrometría de masas

Base de datos de PRoteomics IDEntifications

ProteomicsDB: un recurso de proteoma de múltiples organismos


Variaciones de la biodisponibilidad de la melatonina en humanos

La melatonina como complemento alimenticio se usa ampliamente en los EE. UU. Y en varios otros países. Sus ventas excedieron una vez la vitamina C en los Estados Unidos [115]. Sin embargo, la farmacocinética de la melatonina, especialmente su biodisponibilidad en humanos, no ha atraído suficiente atención. En estudios con animales, particularmente en roedores de laboratorio, los parámetros farmacocinéticos de la melatonina, incluida su vida media (t1/2), tasa de aclaramiento (Cl) y la biodisponibilidad son uniformes y presentan pequeñas variaciones individuales. En comparación con los roedores, la biodisponibilidad de la melatonina en humanos es escasa. Un estudio claro que utilizó melatonina deuterio como estándar de referencia reveló que la biodisponibilidad de la melatonina consumida por vía oral era tan baja como el 1% en algunos sujetos con una diferencia sexual obvia. La biodisponibilidad de la melatonina en las mujeres es el doble que en los hombres, es decir, 16,8 ± 12,7% frente a 8,6 ± 3,9%, respectivamente [116]. La baja biodisponibilidad de la melatonina se atribuye a su efecto de primer paso a través del hígado. Sin embargo, no se puede descartar que una cantidad considerable de melatonina pueda ser degradada por el CYP450 1B1 gastrointestinal, que pueda participar en el ciclo hepatoentérico o ser consumida por mecanismos no enzimáticos, incluida una interacción con ROS / RNS. Se han informado niveles altos de melatonina en la bilis de ratas [39] y en el tracto biliar de humanos [117], lo que sugiere que una porción de melatonina ingerida por vía oral puede entrar en la circulación hepatoentérica.

Además de su baja biodisponibilidad, se han observado variaciones individuales sustanciales en la biodisponibilidad de la melatonina. Esta variación puede ser de hasta 37 veces. Las variaciones individuales promedio calculadas a partir de los datos disponibles en términos de biodisponibilidad de la melatonina en humanos difieren en aproximadamente 18 veces (Tabla 1). Las mayores variaciones individuales probablemente se deban a las propiedades heterogénicas de la expresión del gen del subtipo del citocromo C P450 en humanos.

Estudios Rango de biodisponibilidad Pliegues de diferencia Valor medio de biodisponibilidad
Waldhauser y col. [118] 3-76% a 25.3 22,0% b
Di et al. [119] 10–56% 5.6 33.0%
DeMuro et al. [120] 7,3–20,3 b 3.0 14.3%
Fourtillan y col. (117) 1–37% 37 8,7% (hombres) 16,8% (mujeres)
Promedio 17.7 18.9%

La baja biodisponibilidad (promedio 18,9%) y la gran variación individual (promedio 17,7 veces) bien pueden explicar las diferentes respuestas en sujetos que toman melatonina por vía oral. Actualmente, la fórmula de melatonina más popular disponible comercialmente es una tableta de 3 mg. Para algunos sujetos, esta dosis cuando se toma para beneficiar el sueño puede inducir somnolencia al día siguiente para otros, cuya biodisponibilidad es baja, esta dosis puede no ser suficiente para tratar el insomnio o trastornos relacionados. Para obtener los efectos óptimos del tratamiento con melatonina, se sugiere la individualización de la dosis en función de los niveles de melatonina sérica o salival después de la administración de melatonina o ajustando la dosis en función de las respuestas de los sujetos.

Las interacciones medicamentosas también influyen en la biodisponibilidad de la melatonina. Por ejemplo, la coadministración de melatonina con el inhibidor de CYP1A2, fluvoxamina (también un inhibidor de la recaptación de serotonina), en sujetos sanos, da como resultado un aumento de 17 veces en los niveles de melatonina en sangre [122]. Estos datos también indican indirectamente una biodisponibilidad de melatonina muy baja en humanos, probablemente & lt6% en este estudio. Cuando la melatonina se toma con 200 mg de cafeína, equivalente a una taza grande de café, su biodisponibilidad aumenta un 140% presumiblemente porque ambos son sustratos de CYP1A2 [123]. También observamos que, de forma concomitante, cuando se tomaba melatonina con vitamina E y vitamina C en seres humanos, aumentaba la biodisponibilidad de la melatonina (Tan & Reiter, observaciones no publicadas). Aclarar la farmacocinética de la melatonina y su interacción con otras sustancias ayudará a comprender las diferencias de dosis en una variedad de situaciones y entre individuos.


La glándula pineal evolucionó para mejorar la visión, según la teoría de un científico del NICHD

La glándula pineal, que regula los ciclos del sueño y la vigilia, parece haber evolucionado como una forma indirecta de mejorar la visión, al mantener los compuestos tóxicos lejos del ojo, según una nueva teoría de un investigador del Instituto Nacional de Salud Infantil y Desarrollo humano en los Institutos Nacionales de Salud.

La teoría tiene implicaciones para comprender la degeneración macular, una condición que causa pérdida de visión en personas de 60 años o más.

La teoría se describe en agosto Revista de ritmos biológicos y representa el trabajo de David Klein, Ph.D., Jefe de la Sección de Neuroendocrinología del NICHD. El Dr. Klein estudia la melatonina, la hormona pineal que regula los ciclos de sueño y vigilia.

"La teoría del Dr. Klein amplía nuestra comprensión de la glándula pineal como un factor que controla los ritmos diarios del cuerpo", dijo Duane Alexander, M.D., Director del Instituto Nacional de Salud Infantil y Desarrollo Humano. "La nueva teoría de Klein nos recuerda el origen evolutivo común de las células en la glándula pineal y la retina y nos obliga a mirar una de las enzimas utilizadas para producir melatonina desde una nueva perspectiva: como un sistema desintoxicante en la retina".

Brevemente, la teoría sostiene que la melatonina fue al principio una especie de basura celular, un subproducto creado en las células del ojo cuando las sustancias normalmente tóxicas se volvieron inofensivas. Sin embargo, hace aproximadamente 500 millones de años, los antepasados ​​de los animales actuales se volvieron dependientes de la melatonina como señal de oscuridad. A medida que crecía la necesidad de mayores cantidades de melatonina, la glándula pineal se desarrolló como una estructura separada de los ojos, para mantener las sustancias tóxicas necesarias para producir melatonina lejos del tejido sensible del ojo.

Para que la vista sea posible, explicó el Dr. Klein, una forma de vitamina A (también llamada retinaldehído) debe unirse químicamente a la rodopsina, una proteína que se encuentra en las células de la retina que detectan la luz (los fotorreceptores). Cuando es impactada por la luz, la combinación retinaldehído-rodopsina sufre cambios físicos que inician una serie de reacciones químicas. En última instancia, estas reacciones generan una señal eléctrica que viaja al cerebro y hace posible la visión.

Este es un evento único para cada combinación de retinal-rodopsina. En el proceso, la luz también inactiva el retinaldehído y lo libera de la rodopsina. El retinaldehído libre e inactivo luego se recicla dentro de la retina a una forma activa, de modo que pueda participar nuevamente en la detección de luz.

Sin embargo, surge un problema durante este proceso de reciclaje: cuando el retinaldehído no está unido a la rodopsina, puede combinarse con sustancias conocidas como arilalquilaminas. Klein ha descubierto que una molécula de arilalquilamina puede combinarse con dos moléculas de retinaldehído para formar una sustancia conocida como arilalquilamina bis-retiniana. Una vez que esto ocurre, la molécula de retinaldehído ya no se puede utilizar para detectar la luz, dijo el Dr. Klein. Las arilalquilaminas son potencialmente peligrosas porque pueden dañar muchas sustancias químicas en la célula. Algunas arilalquilaminas se generan de forma natural. Estos incluyen tiramina, triptamina, feniletilamina y serotonina. Además, el Dr. Klein teoriza que otras arilalquilaminas tóxicas también estaban presentes en el medio ambiente al principio de la evolución.

Hace aproximadamente 500 millones de años, los animales adquirieron la capacidad de producir una enzima conocida como arilalquilamina N-acetiltransferasa (AANAT). A principios de este año, el Dr. Klein y sus colegas presentaron evidencia de que las células animales pueden haber adquirido esta capacidad al incorporar ADN bacteriano en su propio ADN. Un comunicado que describe el hallazgo anterior aparece en http://www.nichd.nih.gov/news/releases/Pages/genes.aspx.

AANAT altera químicamente las arilalquilaminas para evitar que se combinen con el retinaldehído. AANAT altera la serotonina cambiándola a un compuesto conocido como N-acetilserotonina. Sin embargo, la N-acetilserotonina sigue siendo tóxica para las células de la retina, aunque menos que la serotonina. Una segunda enzima, la hidroxiindol-O-metiltransferasa (HIOMT) modificó aún más la N-acetilserotonina, convirtiéndola en melatonina, que es relativamente inofensiva para el ojo. En el artículo anterior, el Dr. Klein y sus compañeros de trabajo también proporcionaron evidencia de que, como AANAT, HIOMT se originó en bacterias. Él cree que estas enzimas, las cuales son esenciales para la síntesis de melatonina, fueron adquiridas por el ojo ancestral para aumentar la sensibilidad a la luz. Es de suponer que las enzimas se adquirieron antes de la evolución de la glándula pineal.

El Dr. Klein explicó que, en el antepasado de los animales superiores de hoy, la conversión de serotonina en melatonina aumentaba por la noche, como una forma de hacer que la visión fuera más sensible a las condiciones de poca luz. La conversión impidió que la serotonina se combinara con el retinaldehído por la noche, cuando era necesario para detectar niveles bajos de luz, de modo que estos animales ancestrales pudieran funcionar bien con poca luz.

Gradualmente, el organismo temprano reconoció el aumento de la melatonina como una señal de la noche y se volvió dependiente de ella, según la teoría del Dr. Klein. Esta señal se utilizó para sincronizar sus ciclos diarios con el ciclo ambiental nocturno y diurno. Para que esta señal sea confiable, el organismo necesitaba un suministro constante de serotonina en estas células. Sin embargo, este requisito de niveles más altos de serotonina entraba en conflicto con la necesidad de una mayor detección de luz porque la serotonina reducía el retinaldehído. Este conflicto se resolvió con la evolución de una segunda célula fotorreceptora, una que albergaba la producción de melatonina. La evolución de la segunda célula fotorreceptora permitió que la célula fotorreceptora original alcanzara niveles más altos de sensibilidad a la luz porque no estaba dedicada a producir altos niveles de melatonina. Finalmente, los fotorreceptores productores de melatonina dieron lugar a la glándula pineal.

"Para aumentar ambos conjuntos de procesos, la síntesis y la fotodetección de melatonina, la evolución los puso en células separadas", dijo el Dr. Klein. "Una célula se movió hacia la detección de luz, la otra hacia la producción de melatonina".

En apoyo de su teoría, el Dr. Klein señaló que las células fotorreceptoras de la retina se parecen mucho a las células de la glándula pineal y que las células pineales de los submamíferos (como peces, ranas y pájaros) detectan la luz. Además, el origen de la melatonina en la célula fotorreceptora ancestral está indicado por la capacidad de las retinas de ratones, peces, ranas y aves para producir pequeñas cantidades de melatonina.

El Dr. Klein señala que a medida que evolucionaron los humanos y otros primates, la producción de melatonina se perdió en la retina y se restringió a la glándula pineal. Aunque la melatonina ya no se fabrica en la retina de los primates, AANAT todavía lo es. El Dr. Klein sospecha que la enzima juega un papel en la protección de la retina humana.Es probable que las arilalquilaminas (triptamina, feniletilamina y tiramina) se produzcan en las células de la retina, y AANAT puede funcionar para convertirlas en formas menos dañinas.

En consecuencia, AANAT puede desempeñar dos funciones: en la retina tendría una función de desintoxicación, mientras que en la glándula pineal tendría una función en la síntesis de melatonina. Es posible, dijo el Dr. Klein, que los niveles bajos de AANAT podrían conducir al deterioro de la retina observada en la degeneración macular y, tal vez, podría ser posible prevenir esta enfermedad aumentando los niveles de AANAT.


Resultados

Pesos corporales

Al nacer, las proporciones de sexos fueron las mismas en todos los grupos (datos no mostrados). La desnutrición en la vida temprana redujo significativamente el peso al nacer en las crías UNP y UNPL en comparación con Cont. Esta reducción en el peso corporal persistió hasta el destete, y en la UNPL, persistió hasta la edad adulta [13] (Tabla 3). No encontramos ningún efecto de la exposición a la desnutrición en las primeras etapas de la vida sobre el peso de los ovarios adultos [13].

Peso corporal y ovárico de la descendencia. *

Grupo nutricional. Peso al nacer (g). Peso al destete (g). Peso corporal adulto (g). Peso ovárico adulto (g).
Control 6,1 ± 0,09 una 59,6 ± 0,7 una 301 ± 4,9 a 0.103 ± 0.005
UNP 4,8 ± 0,06 b 54,8 ± 1,2 b 292,4 ± 7,1 a 0.096 ± 0.005
UNPL 4,8 ± 0,08 b 32,7 ± 1,3 b 263,3 ± 6,6 b 0.097 ± 0.006
UNL 6,0 ± 0,08 b 39,7 ± 1,2 b 292,6 ± 15,6 a 0.100 ± 0.006
Grupo nutricional. Peso al nacer (g). Peso al destete (g). Peso corporal adulto (g). Peso ovárico adulto (g).
Control 6,1 ± 0,09 una 59,6 ± 0,7 una 301 ± 4,9 a 0.103 ± 0.005
UNP 4,8 ± 0,06 b 54,8 ± 1,2 b 292,4 ± 7,1 a 0.096 ± 0.005
UNPL 4,8 ± 0,08 b 32,7 ± 1,3 b 263,3 ± 6,6 b 0.097 ± 0.006
UNL 6,0 ± 0,08 b 39,7 ± 1,2 b 292,6 ± 15,6 a 0.100 ± 0.006

Los datos se presentan como media ± SEM. Los datos se derivan de Bernal et al. [13].

Los valores con letras diferentes son significativamente diferentes entre sí, PAG & lt 0,001.

Peso corporal y ovárico de la descendencia. *

Grupo nutricional. Peso al nacer (g). Peso al destete (g). Peso corporal adulto (g). Peso ovárico adulto (g).
Control 6,1 ± 0,09 una 59,6 ± 0,7 una 301 ± 4,9 a 0.103 ± 0.005
UNP 4,8 ± 0,06 b 54,8 ± 1,2 b 292,4 ± 7,1 a 0.096 ± 0.005
UNPL 4,8 ± 0,08 b 32,7 ± 1,3 b 263,3 ± 6,6 b 0.097 ± 0.006
UNL 6,0 ± 0,08 b 39,7 ± 1,2 b 292,6 ± 15,6 a 0.100 ± 0.006
Grupo nutricional. Peso al nacer (g). Peso al destete (g). Peso corporal adulto (g). Peso ovárico adulto (g).
Control 6,1 ± 0,09 una 59,6 ± 0,7 una 301 ± 4,9 a 0.103 ± 0.005
UNP 4,8 ± 0,06 b 54,8 ± 1,2 b 292,4 ± 7,1 a 0.096 ± 0.005
UNPL 4,8 ± 0,08 b 32,7 ± 1,3 b 263,3 ± 6,6 b 0.097 ± 0.006
UNL 6,0 ± 0,08 b 39,7 ± 1,2 b 292,6 ± 15,6 a 0.100 ± 0.006

Los datos se presentan como media ± SEM. Los datos se derivan de Bernal et al. [13].

Los valores con letras diferentes son significativamente diferentes entre sí, PAG & lt 0,001.

La exposición a la desnutrición en la vida temprana aumentó el estrés ovárico ER y la apoptosis folicular, pero disminuyó la autofagia ovárica en la descendencia adulta

La proteína de unión a caja de X de ovario 1 empalmada (XBP1s), total (XBP1t) y su proporción se determinaron como un marcador de estrés ER en los ovarios de la descendencia. XBPT1s ováricos: Las proporciones de ARNm de XBP1t aumentaron significativamente en los ovarios de descendientes nacidos de madres desnutridas (PAG & lt 0,001) (figura 1A). El análisis post hoc demostró que, aunque la descendencia UNP y UNPL mostraron un aumento en la relación XBP1s: XBP1t en comparación con la descendencia Cont, solo UNPL alcanzó significación estadística (UNPL PAG & lt 0,001) (figura 1A). La apoptosis folicular aumentó significativamente en los ovarios de la descendencia de madres desnutridas (PAG & lt 0,001) (figura 1B). El análisis post hoc demostró un aumento estadísticamente significativo en la proporción de células foliculares apoptóticas en los ovarios de UNP (PAG & lt 0.05) y UNPL (PAG & lt 0.05) comparados con la descendencia Cont (Fig. 1B).

La exposición temprana a la desnutrición aumenta el estrés ovárico del RE y la apoptosis folicular, pero disminuye la autofagia ovárica en la descendencia adulta. A) La desnutrición materna durante el embarazo y la lactancia (UNPL) resultó en un aumento de los niveles de ARNm de los genes relacionados con el estrés del RE expresados ​​como una proporción de XBP1s a XBP1t (n = 6-7 por grupo). B) La desnutrición materna durante el embarazo y durante el embarazo y la lactancia resultó en un aumento de la apoptosis de las células foliculares (medida como tinción TUNEL positiva) como proporción del área total analizada. C) La desnutrición materna disminuyó los componentes clave del proceso de autofagia, incluida la proteína 1A / 1B-cadena ligera 3 asociada a los microtúbulos (LC3a) en los ovarios UNP. D) Beclin 1 en ovarios de descendencia UNP y UNPL. mi) Las fotografías representan secciones de ovario teñidas para proteína Beclin1 inmunopositiva utilizando sustrato DAB y contrateñidas con hematoxilina. La proteína Beclin1 inmunopositiva se identifica mediante tinción marrón. Barras = 100 μm. Los controles negativos no muestran tinción positiva (datos no mostrados) n = 5 por grupo. F) Los datos de expresión génica se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05 para todos los genes. Análisis post hoc (Bonferroni): *PAG & lt 0,05 para las crías desnutridas en comparación con las crías de control y UNL. Cont, descendencia de madres alimentadas con una dieta de control UNP, descendencia de madres desnutridas solo durante el embarazo UNPL, descendencia de madres desnutridas durante el embarazo y lactancia UNL, descendencia de madres desnutridas solo durante la lactancia n = 6–7 por grupo.

La exposición temprana a la desnutrición aumenta el estrés ovárico del RE y la apoptosis folicular, pero disminuye la autofagia ovárica en la descendencia adulta. A) La desnutrición materna durante el embarazo y la lactancia (UNPL) resultó en un aumento de los niveles de ARNm de los genes relacionados con el estrés del RE expresados ​​como una proporción de XBP1s a XBP1t (n = 6-7 por grupo). B) La desnutrición materna durante el embarazo y durante el embarazo y la lactancia resultó en un aumento de la apoptosis de las células foliculares (medida como tinción TUNEL positiva) como proporción del área total analizada. C) La desnutrición materna disminuyó los componentes clave del proceso de autofagia, incluida la proteína 1A / 1B-cadena ligera 3 asociada a los microtúbulos (LC3a) en los ovarios UNP. D) Beclin 1 en ovarios de descendencia UNP y UNPL. mi) Las fotografías representan secciones de ovario teñidas para la proteína Beclin1 inmunopositiva usando sustrato DAB y teñidas con hematoxilina. La proteína Beclin1 inmunopositiva se identifica mediante tinción marrón. Barras = 100 μm. Los controles negativos no muestran tinción positiva (datos no mostrados) n = 5 por grupo. F) Los datos de expresión génica se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05 para todos los genes. Análisis post hoc (Bonferroni): *PAG & lt 0,05 para las crías desnutridas en comparación con las crías de control y UNL. Cont, descendencia de madres alimentadas con una dieta de control UNP, descendencia de madres desnutridas solo durante el embarazo UNPL, descendencia de madres desnutridas durante el embarazo y lactancia UNL, descendencia de madres desnutridas solo durante la lactancia n = 6–7 por grupo.

La exposición a la desnutrición en la vida temprana resultó en una disminución significativa en los niveles de ARNm de ovario adulto de Beclin1 (PAG & lt 0,001), un componente establecido de la maquinaria autofágica, y del marcador autofagasoma LC3 (PAG & lt 0,001 Fig. 1C). Los análisis post hoc mostraron una disminución estadísticamente significativa en los niveles de ARNm de Beclin1 en UNP (PAG = 0,005) y UNPL (PAG & lt 0,001) descendencia en comparación con descendencia Cont (Fig. 1D). Aunque los grupos UNP y UNPL mostraron niveles más bajos de ARNm de LC3, los análisis post hoc mostraron una disminución estadísticamente significativa en los niveles de ARNm de LC3 solo en la descendencia de UNPL (PAG & lt 0,001 UNP: PAG = 0.06) (Figura 1C). Se inmunoteñieron secciones de ovario para la proteína Beclin1 para determinar la localización folicular. Observamos que la proteína Beclin1 se localiza en vasos sanguíneos de ovario, ovocitos y estroma ovárico (Fig. 1E). De acuerdo con los niveles de ARNm, observamos una disminución en la densidad media de inmunotinción de la proteína Beclin1 en secciones de ovario en UNP (PAG & lt 0.001) y UNPL (PAG & lt 0.05) en comparación con el grupo Cont (Fig. 1, E y F). La descendencia UNL mostró una tinción similar a los controles (Fig. 1, E y F). Beclin 1 inmunopositivo estaba muy localizado en ovocitos y vasos sanguíneos y menos en células estromales, granulosas y tecales. Todos los controles negativos en los ensayos de tinción inmunohistoquímica no mostraron tinción positiva (datos no mostrados).

Exposición a la desnutrición en la vida temprana Reducción de la densidad de los vasos sanguíneos de los ovarios e inmunotinción de VEGF y VEGFR2 en los ovarios descendientes

Se ha demostrado que los eventos tempranos de la vida modulan la vascularización de los órganos en la descendencia [46, 47], por lo que nos propusimos investigar si la densidad de los vasos sanguíneos se alteraba de manera similar en el ovario. La exposición a la desnutrición en la vida temprana disminuyó significativamente la vascularización ovárica de una manera que dependía del momento de la desnutrición. La densidad de los vasos sanguíneos, incluidos los capilares perifoliculares, según se define por la presencia de inmunotinción del marcador de células endoteliales CD31 como proporción del área total, se redujo significativamente en UNP (PAG & lt 0.05) y UNPL (PAG & lt 0.05) en comparación con Cont (Fig. 2). La vascularización en la descendencia UNL no fue diferente a la del grupo Cont.

La desnutrición en la vida temprana reduce la densidad de los vasos sanguíneos de los ovarios. Las fotografías representan secciones de ovario inmunoteñidas para el marcador de células endoteliales CD31 usando sustrato DAB y contrateñidas con hematoxilina. A) La proteína inmunopositiva CD31 se identifica mediante tinción marrón indicativa de sustrato DAB. La tinción de células endoteliales positivas para CD31 dentro de las estructuras de los vasos sanguíneos del ovario se indica mediante flechas blancas. Los capilares perifoliculares, que proporcionan suministro vascular al folículo en desarrollo y / o al cuerpo lúteo, se indican con puntas de flecha blancas. Los controles negativos no muestran tinción positiva (datos no mostrados). Ampliación original × 200. B) La desnutrición materna resultó en una disminución significativa en la proporción de inmunotinción de CD31 (expresada como porcentaje del área de los vasos del área total de ovarios analizada) en los ovarios de la descendencia. Los datos se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05 para los niños desnutridos en comparación con los descendientes de Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 en comparación con la descendencia Cont n = 5 por grupo. Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.

La desnutrición en la vida temprana reduce la densidad de los vasos sanguíneos de los ovarios. Las fotografías representan secciones de ovario inmunoteñidas para el marcador de células endoteliales CD31 usando sustrato DAB y contrateñidas con hematoxilina. A) La proteína inmunopositiva CD31 se identifica mediante tinción marrón indicativa de sustrato DAB. La tinción de células endoteliales positivas para CD31 dentro de las estructuras de los vasos sanguíneos del ovario se indica mediante flechas blancas. Los capilares perifoliculares, que proporcionan suministro vascular al folículo en desarrollo y / o al cuerpo lúteo, se indican con puntas de flecha blancas. Los controles negativos no muestran tinción positiva (datos no mostrados). Ampliación original × 200. B) La desnutrición materna resultó en una disminución significativa en la proporción de inmunotinción de CD31 (expresada como porcentaje del área de los vasos del área total de ovarios analizada) en los ovarios de la descendencia. Los datos se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05 para los niños desnutridos en comparación con los descendientes de Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 en comparación con la descendencia Cont n = 5 por grupo. Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.

Se ha descubierto que el VEGFR2 se expresa en gran medida en las células del estroma, la granulosa y la teca del ovario de rata [48], y los cambios críticos en la sensibilidad de las células de la granulosa al VEGF parecen estar mediados por el VEGFR2 [49]. También se ha demostrado que VEGFR2 no solo media la vascularización, sino que también funciona como un agente antiapoptótico en células de la granulosa de rata y es necesario para la selección de folículos dominantes. De acuerdo con nuestro aumento observado en la apoptosis y la pérdida de densidad de vasos, la restricción de nutrientes en la vida temprana resultó en una reducción significativa en la inmunopresencia de VEGF y VEGFR2 en ovarios adultos (Fig. 3). La tinción inmunohistoquímica mostró una disminución significativa en la proteína VEGF y VEGFR2 en células estromales y foliculares como proporción del área total analizada en UNP (PAG & lt 0.05) y UNPL (PAG & lt 0.05) en comparación con la descendencia Cont. De manera similar, la descendencia de madres desnutridas demostró una menor colocalización de VEGF y VEGFR2 en UNP (PAG & lt 0.05) y UNPL (PAG & lt 0.05) en comparación con la descendencia Cont (Fig. 3). Todos los controles negativos no mostraron tinción positiva (datos no mostrados).

La desnutrición en la vida temprana reduce VEGF, VEGFR2 y su colocalización en los ovarios de la descendencia. A) Las fotografías representan la tinción inmunopositiva de VEGF (verde), VEGFR2 (rojo) y la colocalización de VEGF / VEGFR2 (amarillo). Los controles negativos no muestran tinción positiva (datos no mostrados). Ampliación original × 200. B) La desnutrición en las primeras etapas de la vida dio como resultado una disminución significativa en la proporción de inmunotinción de VEGF, VEGFR2 y VEGF / VEGFR2 (expresada como porcentaje del área teñida positiva del área ovárica total analizada) en los ovarios descendientes. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05. Análisis post hoc (Bonferroni): *PAG & lt 0,05 para las crías desnutridas en comparación con las crías de control (n = 5 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia. Los tipos de células se indican mediante flechas de colores: células de la granulosa (flecha violeta), células de la teca (flecha naranja) y estroma ovárico (flecha azul claro).

La desnutrición en la vida temprana reduce VEGF, VEGFR2 y su colocalización en los ovarios de la descendencia. A) Las fotografías representan la tinción inmunopositiva de VEGF (verde), VEGFR2 (rojo) y la colocalización de VEGF / VEGFR2 (amarillo). Los controles negativos no muestran tinción positiva (datos no mostrados). Ampliación original × 200. B) La desnutrición en las primeras etapas de la vida dio como resultado una disminución significativa en la proporción de inmunotinción de VEGF, VEGFR2 y VEGF / VEGFR2 (expresada como porcentaje del área teñida positiva del área ovárica total analizada) en los ovarios descendientes. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05. Análisis post hoc (Bonferroni): *PAG & lt 0,05 para las crías desnutridas en comparación con las crías de control (n = 5 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia. Los tipos de células se indican mediante flechas de colores: células de la granulosa (flecha violeta), células de la teca (flecha naranja) y estroma ovárico (flecha azul claro).

Citocinas proinflamatorias alteradas por exposición a desnutrición en la vida temprana y moléculas de señalización ascendentes en los ovarios de la descendencia

Anteriormente informamos que la descendencia expuesta a desnutrición temprana demuestra niveles aumentados de estrés oxidativo ovárico [13], y debido a que ahora demostramos un aumento en un marcador de estrés ER, investigamos una vía de señalización central que podría contribuir a estos cambios observados . Los hijos nacidos de madres desnutridas demostraron niveles elevados de ARNm de los genes que codifican tanto la subunidad catalítica (p110α) como la subunidad reguladora (p85α) de PI3K, aunque solo p110α alcanzó significación estadística (PAG & lt 0,001) (figura 4). El análisis post hoc demostró que los niveles de ARNm de PIK3CA (p110α) estaban significativamente elevados en UNP (PAG = 0.023) y UNPL (PAG & lt 0,001), pero no la descendencia UNL, en comparación con la descendencia Cont (Fig. 4). De acuerdo con esto, los niveles de ARNm del factor nuclear kappa de las células B (NFκB o RelA / p65) aumentaron significativamente en los ovarios de la descendencia de madres desnutridas (PAG & lt 0,001) (figura 4). El análisis post hoc demostró un aumento en los niveles de ARNm de NFκB en UNP (PAG = 0,002), UNPL (PAG & lt 0.001) y UNL (PAG = 0.017) en comparación con la descendencia Cont (Fig.4). Aunque la descendencia de madres desnutridas tendía a demostrar niveles elevados de ARNm de la citocina proinflamatoria IL-6, esta diferencia no fue estadísticamente significativa (PAG = 0.063) en comparación con la descendencia Cont (Fig.4). Los niveles de ARNm ovárico de IL-1β, un factor proinflamatorio que se ha demostrado que suprime la apoptosis en el ovario de roedores [50], disminuyó en la descendencia de madres desnutridas (PAG & lt 0,001). El análisis post hoc demostró que los niveles de ARNm de IL-1β disminuyeron significativamente en UNP (PAG & lt 0,001) y UNPL (PAG & lt 0,001) pero no descendientes UNL en comparación con Cont (Fig. 4).

La desnutrición en la vida temprana altera las citocinas proinflamatorias y las moléculas de señalización ascendentes en los ovarios de la descendencia. La desnutrición temprana resultó en un aumento significativo en la subunidad catalítica de PI3 quinasa PI3KCA (A), p85 (B) y NFκB (C) niveles de ARNm, pero una disminución en p21 (mi) e IL-1β proinflamatoria (F). D) No se observó ningún efecto sobre IL-6. Los datos se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05 para todos los genes excepto para IL-6 desnutridos en comparación con la descendencia Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 en comparación con la descendencia Cont para PI3KCA y p21 y para IL-1β *PAG & lt 0.05 en comparación con Cont y también en comparación con UNL (n = 6–7 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.

La desnutrición en la vida temprana altera las citocinas proinflamatorias y las moléculas de señalización ascendentes en los ovarios de la descendencia. La desnutrición temprana resultó en un aumento significativo en la subunidad catalítica de PI3 quinasa PI3KCA (A), p85 (B) y NFκB (C) niveles de ARNm, pero una disminución en p21 (mi) e IL-1β proinflamatoria (F). D) No se observó ningún efecto sobre IL-6. Los datos se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0,05 para todos los genes excepto para IL-6 desnutridos en comparación con la descendencia Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 en comparación con la descendencia Cont para PI3KCA y p21 y para IL-1β *PAG & lt 0.05 en comparación con Cont y también en comparación con UNL (n = 6–7 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.

La restricción de nutrientes materna también disminuyó los niveles de ARNm del gen que codifica el inhibidor de quinasa dependiente de ciclina 1 (p21) (gen CDKN1A) (PAG = 0,005) (Figura 4). El análisis post hoc demostró que esto se puede atribuir en gran medida a una disminución significativa en la descendencia de UNP (PAG = 0.049) y no los grupos UNPL o UNL en comparación con la descendencia Cont (Fig.4). Esta disminución es consistente con nuestra pérdida de folículos ováricos previamente observada [13] y el papel de p21 en la inhibición de la proliferación celular.

Exposición a la desnutrición en la vida temprana Niveles ováricos reducidos de la enzima sintetizadora de melatonina HIOMT

La melatonina, además de su papel en la ritmicidad circadiana, también es un conocido antioxidante en el ovario [39]. Debido a que previamente hemos demostrado que la desnutrición en las primeras etapas de la vida da como resultado un aumento de los niveles de estrés oxidativo ovárico [13], investigamos si esto puede estar asociado con cambios en la capacidad del ovario para producir melatonina. La desnutrición en la vida temprana resultó en una disminución significativa en los niveles de ARNm de HIOMT (PAG = 0,002) (figura 5). El análisis post hoc demostró que aunque la descendencia de UNP tendía a tener niveles más bajos de ARNm de HIOMT, las diferencias eran significativas solo en UNPL (PAG = 0,038) descendencia en comparación con la descendencia Cont y UNL (Fig. 5). No pudimos encontrar niveles detectables de ARNm de los dos receptores de melatonina conocidos en el ovario [51].

La desnutrición en la vida temprana altera los niveles ováricos de HIOMT. La desnutrición en la vida temprana resultó en una disminución significativa en la expresión de ARNm ovárico de hidroxiindol O-metiltransferasa (HIOMT) de una manera que depende del momento de la restricción de nutrientes. Los datos se presentan como medias ± SEM. Efecto principal del ANOVA unidireccional: dieta materna PAG & lt 0,05 para los niños desnutridos en comparación con los descendientes de Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 para UNPL (PAG = 0,1 UNP) en comparación con la descendencia Cont y UNL (n = 6–7 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.

La desnutrición en la vida temprana altera los niveles ováricos de HIOMT. La desnutrición en la vida temprana resultó en una disminución significativa en la expresión de ARNm ovárico de hidroxiindol O-metiltransferasa (HIOMT) de una manera que depende del momento de la restricción de nutrientes. Los datos se presentan como medias ± SEM. Efecto principal del ANOVA unidireccional: dieta materna PAG & lt 0,05 para los niños desnutridos en comparación con los descendientes de Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 para UNPL (PAG = 0,1 UNP) en comparación con la descendencia Cont y UNL (n = 6–7 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.

Exposición a la desnutrición en la vida temprana Genes de reloj circadianos centrales alterados en los ovarios de la descendencia

Existe una estrecha relación entre la melatonina y los genes del reloj [40, 52], y las alteraciones en la expresión génica controlada por el reloj debido a la desnutrición prenatal se han relacionado con la disfunción metabólica en la descendencia más adelante en la vida [53]. Los ratones knockout del gen reloj han ilustrado la importancia de los genes del reloj en la regulación de la función reproductiva [54], y recientemente, la obesidad materna se ha asociado con una expresión alterada del gen del reloj en los ovarios de la descendencia [41]. Por lo tanto, investigamos el efecto de la exposición a la desnutrición en las primeras etapas de la vida sobre los niveles de ARNm ovárico de la descendencia de los genes centrales del reloj circadiano. La desnutrición en la vida temprana resultó en un aumento significativo en los niveles de ARNm de CLOCK (PAG = 0,015). El análisis post hoc demostró un aumento en los niveles de ARNm del reloj ovárico en UNPL (PAG = 0.028) y UNL (PAG = 0.046), pero no la descendencia UNP en comparación con la descendencia Cont (Fig.6). Aunque la desnutrición temprana tendió a aumentar los niveles de ARNm de BMAL1 (también conocido como Arntl), esta diferencia no fue estadísticamente significativa (PAG = 0,081). Los niveles de ARNm de criptocromo 1 (CRY1) de ovario fueron significativamente más altos en la descendencia desnutrida (efecto principal PAG & lt 0.001 Fig.6). El análisis post hoc demostró que la descendencia desnutrida mostró niveles más altos de ARNm de CRY1 ovárico en comparación con la descendencia Cont, independientemente del momento de la desnutrición materna (UNP, PAG & lt 0,001 UNPL, PAG = 0,004 UNL, PAG = 0.031) (Figura 6). No hubo ningún efecto de la exposición a la desnutrición temprana en los niveles de ARNm de CRY2 ovárico (PAG = 0,464). La exposición a la desnutrición en las primeras etapas de la vida resultó en un aumento significativo en los niveles de ARNm del período ovárico 1 (PER1) (PAG = 0.033) en la descendencia. El análisis post hoc demostró que este aumento se debió en gran parte a un aumento en los niveles de ARNm de PER1 ovárico en UNP (PAG = 0.02) en comparación con la descendencia Cont (Fig. 6), aunque los niveles de UNPL y UNL tendieron a ser más altos, estas diferencias no fueron estadísticamente significativas. Hubo un efecto principal significativo de la desnutrición temprana en los niveles de ARNm de PER2 ovárico en la descendencia (PAG = 0,025), pero el análisis post hoc no demostró diferencias entre los grupos. Los niveles de ARNm del represor transcripcional Rev-erbα, involucrado en la ritmicidad circadiana, no se vieron afectados por la desnutrición temprana (PAG = 0,1) (datos no mostrados).

La desnutrición en la vida temprana altera los genes centrales del reloj circadiano en los ovarios de la descendencia. A, B, C, mi) La desnutrición en las primeras etapas de la vida resultó en un aumento significativo en la expresión de ARNm ovárico de los genes del reloj central en el ovario de una manera que depende del momento de la restricción de nutrientes: CLOCK (A), BMAL 1 (B), CRY1 (C), PER1 (mi). Los datos se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0.05 para todos los genes excepto PER2 (F) y CRY2 (D) niveles de desnutrición en comparación con la descendencia Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 en comparación con la descendencia Cont (n = 6-7 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.

La desnutrición en la vida temprana altera los genes centrales del reloj circadiano en los ovarios de la descendencia. A, B, C, mi) La desnutrición en las primeras etapas de la vida resultó en un aumento significativo en la expresión de ARNm ovárico de los genes del reloj central en el ovario de una manera que depende del momento de la restricción de nutrientes: CLOCK (A), BMAL 1 (B), CRY1 (C), PER1 (mi). Los datos se presentan como medias ± SEM. Principales efectos del ANOVA unidireccional: dieta materna PAG & lt 0.05 para todos los genes excepto PER2 (F) y CRY2 (D) niveles de desnutrición en comparación con la descendencia Cont. Análisis post hoc (Bonferroni): *PAG & lt 0.05 en comparación con la descendencia Cont (n = 6-7 por grupo). Cont, hijos de madres alimentadas con una dieta de control UNP, hijos de madres desnutridas solo durante el embarazo UNPL, hijos de madres desnutridas durante el embarazo y lactancia UNL, hijos de madres desnutridas solo durante la lactancia.


Sustrato Editar

Las MTasas se pueden dividir en tres grupos diferentes en función de las reacciones químicas que catalizan:

  • m6A - los que generan N6-metiladenina EC2.1.1.72
  • m4C: los que generan N4-metilcitosina EC2.1.1.113
  • m5C - los que generan C5-metilcitosina EC2.1.1.37

Las metiltransferasas m6A y m4C se encuentran principalmente en procariotas (aunque la evidencia reciente ha sugerido que m6A es abundante en eucariotas [1]). Las metiltransferasas m5C se encuentran en algunos eucariotas inferiores, en la mayoría de las plantas superiores y en animales que comienzan con los equinodermos.

Las metiltransferasas m6A (ADN metilasa específica de adenina N-6) (A-Mtasa) son enzimas que metilan específicamente el grupo amino en la posición C-6 de las adeninas en el ADN. Se encuentran en los tres tipos existentes de sistemas de modificación de restricción bacteriana (en el sistema de tipo I, la A-Mtasa es el producto del gen hsdM y en el tipo III es el producto del gen mod). Estas enzimas son responsables de la metilación de secuencias de ADN específicas para evitar que el huésped digiera su propio genoma a través de sus enzimas de restricción. Estas metilasas tienen la misma especificidad de secuencia que sus correspondientes enzimas de restricción. Estas enzimas contienen un motivo conservado Asp / Asn-Pro-Pro-Tyr / Phe en su sección N-terminal, esta región conservada podría estar involucrada en la unión del sustrato o en la actividad catalítica. [2] [3] [4] [5] La estructura de N6-MTase TaqI (M.TaqI) se ha resuelto en 2,4 A. La molécula se pliega en 2 dominios, un dominio catalítico N-terminal, que contiene el catalizador y cofactor vinculante, y comprende una hoja beta central de 9 hebras, rodeada por 5 hélices y un dominio de reconocimiento de ADN C-terminal, que está formado por 4 hojas beta pequeñas y 8 hélices alfa. Los dominios N- y C-terminales forman una hendidura que aloja el sustrato de ADN. [6] Se ha propuesto una clasificación de N-MTasas, basada en arreglos de motivos conservados (CM). [5] Según esta clasificación, las N6-MTasas que tienen un motivo DPPY (CM II) que aparece después del motivo FxGxG (CM I) se denominan MTasas de N6-adenina de clase D12. El sistema de restricción y modificación de tipo I está compuesto por tres polipéptidos R, M y S. Las subunidades M (hsdM) y S juntas forman una metiltransferasa que metila dos residuos de adenina en cadenas complementarias de una secuencia de reconocimiento de ADN bipartita. En presencia de la subunidad R, el complejo también puede actuar como una endonucleasa, uniéndose a la misma secuencia diana pero cortando el ADN a cierta distancia de este sitio. Si el ADN se corta o modifica depende del estado de metilación de la secuencia diana. Cuando el sitio objetivo no se modifica, se corta el ADN. Cuando el sitio objetivo está hemimetilado, el complejo actúa como una metiltransferasa de mantenimiento, modificando el ADN de modo que ambas hebras se metilan. hsdM contiene un dominio de hélice alfa en el N-terminal, el dominio N-terminal de HsdM. [7]

Entre las metiltransferasas m6A (metilasa de ADN específica de N-6 adenina) hay un grupo de MTasas huérfanas que no participan en el sistema de restricción / metilación bacteriana. [8] Estas enzimas tienen un papel regulador en la expresión génica y la regulación del ciclo celular. EcoDam de E. coli [9] y CcrM de Caulobacter crescentus [10] son ​​miembros bien caracterizados de esta familia. Más recientemente, CamA de Clostridioides difficile, se demostró que desempeña un papel funcional clave en la esporulación, la formación de biopelículas y la adaptación del huésped. [11]

Las metiltransferasas m4C (metilasas de ADN específicas de citosina N-4) son enzimas que metilan específicamente el grupo amino en la posición C-4 de las citosinas en el ADN. [5] Estas enzimas se encuentran como componentes de los sistemas de modificación de restricción de tipo II en procariotas. Tales enzimas reconocen una secuencia específica en el ADN y metilan una citosina en esa secuencia. Mediante esta acción, protegen el ADN de la escisión por enzimas de restricción de tipo II que reconocen la misma secuencia.

Las metiltransferasas m5C (ADN metilasa específica de citosina C-5) (C5 Mtasa) son enzimas que metilan específicamente el carbono C-5 de las citosinas en el ADN para producir C5-metilcitosina. [12] [13] [14] En células de mamíferos, las metiltransferasas específicas de citosina metilan ciertas secuencias de CpG, que se cree que modulan la expresión génica y la diferenciación celular. En las bacterias, estas enzimas son un componente de los sistemas de modificación de restricción y sirven como herramientas valiosas para la manipulación del ADN. [13] [15] La estructura de la metiltransferasa HhaI (M.HhaI) se ha resuelto en 2,5 A: la molécula se pliega en 2 dominios: un dominio catalítico más grande que contiene sitios de unión catalíticos y cofactores, y un dominio de reconocimiento de ADN más pequeño. [dieciséis]

Se han informado metiltransferasas de ADN altamente conservadas de los tipos m4C, m5C y m6A, [17] que aparecen como objetivos prometedores para el desarrollo de nuevos inhibidores epigenéticos para combatir la virulencia bacteriana, la resistencia a los antibióticos, entre otras aplicaciones biomédicas.

De novo vs.Mantenimiento Editar

De novo Las metiltransferasas reconocen algo en el ADN que les permite metilar nuevas citosinas. Estos se expresan principalmente en el desarrollo embrionario temprano y establecen el patrón de metilación.

Metiltransferasas de mantenimiento añadir metilación al ADN cuando una hebra ya está metilada. Éstos funcionan durante toda la vida del organismo para mantener el patrón de metilación que había sido establecido por las metiltransferasas de novo.

Se han identificado tres ADN metiltransferasas activas en mamíferos. Se denominan DNMT1, [18] DNMT3a, [19] y DNMT3b. [20] Recientemente, se descubrió una cuarta enzima DNMT3c expresada específicamente en la línea germinal masculina del ratón. [21]

DNMT3L [22] es una proteína estrechamente relacionada con DNMT3a y DNMT3b en estructura y crítica para la metilación del ADN, pero parece estar inactiva por sí sola.

DNMT1 Editar

DNMT1 es la metiltransferasa de ADN más abundante en células de mamíferos y se considera que es la metiltransferasa de mantenimiento clave en los mamíferos. Metila predominantemente los dinucleótidos de CpG hemimetilados en el genoma de los mamíferos. A pesar de poder usar citosina hemimetilada y no metilada como sustrato, DNMT1 no está involucrado en de novo metialización del genoma durante el desarrollo embrionario del ratón. [23] El motivo de reconocimiento de la enzima humana involucra solo tres de las bases en el par de dinucleótidos CpG: una C en una hebra y CpG en la otra. Este requisito de especificidad de sustrato relajado le permite metilar estructuras inusuales como los intermedios de deslizamiento del ADN a tasas de novo que igualan su tasa de mantenimiento. [24] Al igual que otras citosina-5 metiltransferasas de ADN, la enzima humana reconoce las citosinas volteadas en el ADN de doble hebra y opera mediante el mecanismo de ataque nucleofílico. [25] En las células cancerosas humanas, DNMT1 es responsable de ambos de novo y metilación de mantenimiento de genes supresores de tumores. [26] [27] La ​​enzima tiene aproximadamente 1.620 aminoácidos de longitud. Los primeros 1.100 aminoácidos constituyen el dominio regulador de la enzima y los residuos restantes constituyen el dominio catalítico. A estos se unen las repeticiones de Gly-Lys. Ambos dominios son necesarios para la función catalítica de DNMT1.

DNMT1 tiene varias isoformas, la DNMT1 somática, una variante de empalme (DNMT1b) y una isoforma específica de ovocitos (DNMT1o). El DNMT1o se sintetiza y almacena en el citoplasma del ovocito y se transloca al núcleo celular durante el desarrollo embrionario temprano, mientras que el DNMT1 somático siempre se encuentra en el núcleo del tejido somático.

Las células madre embrionarias mutantes nulas DNMT1 eran viables y contenían un pequeño porcentaje de ADN metilado y actividad metiltransferasa. Los embriones de ratón homocigóticos para una deleción en Dnmt1 mueren a los 10-11 días de gestación. [28]

TRDMT1 Editar

Aunque esta enzima tiene fuertes similitudes de secuencia con las 5-metilcitosina metiltransferasas de procariotas y eucariotas, en 2006, se demostró que la enzima metila la posición 38 en el ARN de transferencia de ácido aspártico y no metila el ADN. [29] El nombre de esta metiltransferasa se ha cambiado de DNMT2 a TRDMT1 (tRNA ácido aspártico metiltransferasa 1) para reflejar mejor su función biológica. [30] TRDMT1 es la primera citosina metiltransferasa de ARN que se identifica en células humanas.

DNMT3 Editar

DNMT3 es una familia de ADN metiltransferasas que podría metilar CpG hemimetilado y no metilado al mismo ritmo. La arquitectura de las enzimas DNMT3 es similar a la de DNMT1, con una región reguladora unida a un dominio catalítico. Hay cuatro miembros conocidos de la familia DNMT3: DNMT3a, 3b, 3c y 3L.

DNMT3a y DNMT3b pueden mediar en la represión génica independiente de la metilación. DNMT3a puede co-localizarse con la proteína heterocromatina (HP1) y la proteína de unión a metil-CpG (MeCBP). También pueden interactuar con DNMT1, que podría ser un evento cooperativo durante la metilación del ADN. DNMT3a prefiere la metilación de CpG a la metilación de CpA, CpT y CpC, aunque parece haber alguna preferencia de secuencia de metilación para DNMT3a y DNMT3b. DNMT3a metila los sitios CpG a una velocidad mucho más lenta que DNMT1, pero mayor que DNMT3b.

DNMT3L contiene motivos de ADN metiltransferasa y es necesario para establecer huellas genómicas maternas, a pesar de ser catalíticamente inactivo. DNMT3L se expresa durante la gametogénesis cuando tiene lugar la impronta genómica. La pérdida de DNMT3L conduce a la expresión bialélica de genes que normalmente no se expresan en el alelo materno. DNMT3L interactúa con DNMT3a y DNMT3b y se co-localiza en el núcleo. Aunque DNMT3L parece incapaz de metilación, puede participar en la represión transcripcional.

Inhibidores de DNMT Editar

Debido a los efectos epigenéticos de la familia DNMT, se están investigando algunos inhibidores de DNMT para el tratamiento de algunos cánceres: [31]


Ver el vídeo: Variación Porcentual Año a Año con DAX en Power BI (Agosto 2022).